Pesquisar

quarta-feira, 24 de abril de 2019

Genética Microbiana Capítulo 8

Microbiologia - 12ª Ed. 2016

Tortora,Gerard J.; Funke,Berdell R.; Case,Christine L. - Artmed


 Genética microbiana 
Praticamente todas as características microbianas sobre as quais você leu nos capítulos iniciais são controladas ou influenciadas pela hereditariedade. As características hereditárias dos micróbios incluem sua forma, características estruturais, seu metabolismo, sua capacidade de locomoção e de interação com outros organismos. Os organismos individuais transmitem essas características à sua prole através dos genes. O desenvolvimento da resistência a antibióticos nos microrganismos é frequentemente carreado em plasmídeos, como os apresentados na fotografia, que são prontamente transferidos entre as células bacterianas. Eles são responsáveis pela emergência de Staphylococcus aureus resistentes à meticilina e do surgimento recente de Klebsiella pneumoniae resistentes a carbapenemos. A emergência de S. aureus resistentes à vancomicina (VRSA, de vancomycin-resistant S. aureus) constitui uma séria ameaça à assistência aos pacientes. Neste capítulo, você aprenderá como os VRSA adquiriram essa característica. As doenças emergentes são outra razão da importância de se conhecer a genética. Novas doenças são o resultado da mudança genética em alguns organismos existentes; por exemplo, E. coli O157:H7 adquiriu os genes codificadores da toxina Shiga, de Shigella. Atualmente, os microbiologistas estão utilizando a genética para descobrir relações de parentesco entre os organismos, para explorar as origens de microrganismos, como dos vírus HIV e influenza H1N1, e para estudar como os genes são expressos. O Panorama, na página seguinte, destaca os princípios fundamentais da genética, os quais são explicados em mais detalhes ao longo do capítulo. DNA plasmidial de E.coli.

Genética A genética é a ciência da hereditariedade. Ela inclui o estudo dos genes: como eles são replicados, expressos e transferidos de uma geração a outra. O dogma central da biologia molecular descreve como, em geral, o DNA é transcrito em RNA mensageiro, o qual, por sua vez, é traduzido em proteínas que realizam as funções celulares vitais. As mutações introduzem alterações nesse processo – levando ao ganho ou à perda de funções. De que forma as mutações alteram um genoma DNA mRNA Proteína Função DNA mutado mRNA mutado Proteína alterada Função alterada Cadeia típica de eventos descrita pelo dogma central As mutações podem ser provocadas por substituições de base ou mutações de troca de fase de leitura. TACTTCA AUGAAGT TAATTCA AU AAGT T Nas mutações de substituição de base, um único par de bases do DNA é alterado. TACTTCA AUGAAGT TA TTCA AU AAGT Nas mutações de troca de fase de leitura, pares de bases do DNA são adicionados ou removidos da sequência, causando uma alteração na sequência de leitura. A expressão gênica bacteriana pode ser regulada por óperons, os quais podem ser indutíveis ou repressíveis. Repressor ativo DNA DNA Repressor inativo Indutor “DESLIGADO” (gene não é expresso) “LIGADO” (gene é expresso) Um óperon indutível inclui genes que estão no modo “desligado”, com o repressor ligado ao DNA, sendo “ligado” através de um indutor ambiental. “LIGADO” (gene é expresso) “DESLIGADO” (gene não é expresso) Um óperon reprimível inclui genes que estão no modo “ligado”, sem um repressor ligado ao DNA, sendo “desligado” através de um repressor e de um correpressor ambiental. DNA DNA Repressor inativo Repressor ativo Correpressor AFM 7 nm Microfotografia de força atômica mostrando moléculas de DNA A alteração de genes bacterianos e/ou da expressão gênica pode causar doenças, impedir o tratamento de doenças ou ser manipulada para o benefício humano. Doença: muitas doenças bacterianas são causadas pela presença de proteínas tóxicas que danificam os tecidos humanos. Essas proteínas tóxicas são codificadas por genes bacterianos. Vibrio cholerae, mostrado abaixo, produz uma enterotoxina que provoca diarreia e uma desidratação severa, que pode ser fatal se não for tratada. MET 0,4 m Resistência a antibióticos: mutações no genoma bacteriano consistem em um dos primeiros passos em direção ao desenvolvimento da resistência a antibióticos. Esse processo ocorreu com Staphylococcus aureus, o qual atualmente é resistente a antibióticos β-lactâmicos, como a penicilina. A meticilina foi introduzida para tratar S. aureus resistentes à penicilina. S. aureus resistentes à meticilina (MRSA, de methicillin-resistant S. aureus), mostrados abaixo, em roxo, correspondem hoje a uma das principais causas de infecções associadas aos cuidados da saúde. MEV 0,3 m Biofilmes: os biofilmes, como o que pode ser observado aqui se desenvolvendo na cerda de uma escova de dente, são produzidos pela alteração da expressão de um gene bacteriano quando as populações são grandes o suficiente. Várias espécies de Streptococcus, incluindo S. mutans, formam biofilmes em dentes e gengivas, contribuindo para o desenvolvimento da placa e da cárie dentária. MEV 5 m Biotecnologia: os cientistas podem alterar o genoma dos microrganismos, inserindo genes capazes de produzir proteínas humanas utilizadas no tratamento de doenças. A insulina, utilizada no tratamento do diabetes, é produzida dessa forma. • A expressão do DNA leva à função celular pela produção de proteínas. • A expressão do DNA pode ser controlada por óperons. • Mutações alteram as sequências do DNA. • Mutações no DNA podem alterar a função bacteriana. CONCEITOS-CHAVE 204 PARTE I Fundamentos de microbiologia Estrutura e função do material genético OBJETIVOS DO APRENDIZADO 8-1 Definir genética, genoma, cromossomo, gene, código genético, genótipo, fenótipo e genômica. 8-2 Descrever como o DNA serve de informação genética. 8-3 Descrever o processo da replicação do DNA. 8-4 Descrever a síntese proteica, incluindo a transcrição, o processamento do RNA e a tradução. 8-5 Comparar a síntese proteica em procariotos e eucariotos. A genética é a ciência da hereditariedade. Ela inclui o estudo dos genes: como eles carreiam a informação, como eles são replicados e transferidos para as gerações subsequentes de células ou entre organismos e como a expressão de suas informações determina as características de um organismo. A informação genética em uma célula é chamada de genoma. O genoma de uma célula inclui seus cromossomos e plasmídeos. Os cromossomos são estruturas contendo DNA que transportam fisicamente a informação hereditária; os cromossomos contêm os genes. Os genes são segmentos de DNA (exceto em alguns vírus, nos quais eles são constituídos de RNA*) que codificam produtos funcionais. Em geral, esses produtos são proteínas, mas também podem ser RNAs (RNA ribossomal, RNA transportador ou microRNA). Vimos, no Capítulo 2, que o DNA é uma macromolécula composta de unidades repetidas, denominadas nucleotídeos. Cada nucleotídeo consiste em uma nucleobase (adenina, timina, citosina ou guanina), uma desoxirribose (um açúcar-pentose) e um grupo fosfato (ver Figura 2.16, p. 44). O DNA dentro de uma célula existe como longos filamentos de nucleotídeos, retorcidos em pares, formando uma dupla-hélice. Cada filamento tem uma fileira alternando açúcar e grupos fosfato (seu arcabouço de açúcar-fosfato) e uma base nitrogenada aderida a cada açúcar no arcabouço. As duas cadeias são mantidas unidas por ligações de hidrogênio existentes entre as bases nitrogenadas. Os pares de bases sempre ocorrem de modo específico: a adenina sempre pareia com a timina, e a citosina sempre pareia com a guanina. Devido a esse pareamento específico de bases, a sequência de bases de uma fita de DNA determina a sequência da outra fita. As duas fitas de DNA são, portanto, complementares. A estrutura do DNA ajuda a explicar as duas características principais do armazenamento da informação biológica. Primeiro, a sequência linear de bases fornece a informação real. A informação genética é codificada pela sequência de bases ao longo do DNA, de modo muito similar à forma como nossa linguagem escrita utiliza uma sequência linear de letras para formar palavras e sentenças. A linguagem genética, entretanto, utiliza um alfabeto contendo somente quatro letras – os quatro tipos de nucleobases no DNA (ou RNA). Contudo, mil dessas quatro bases, o número contido em um gene de tamanho médio, podem ser arranjadas de 41000 formas diferentes. Esse número astronômico explica como os genes podem apresentar variações suficientes para fornecer toda a informação que uma célula necessita para crescer e realizar suas funções. O código genético, o grupo de regras que determina como uma sequência de nucleotídeos é convertida na sequência de aminoácidos de uma proteína, será discutido em mais detalhes posteriormente neste capítulo. Segundo, a estrutura complementar permite a duplicação precisa do DNA durante a divisão celular. Cada célula-filha recebe uma das fitas parentais originais, assegurando, então, que uma das fitas funcionará corretamente. Grande parte do metabolismo celular está relacionada à tradução da mensagem genética dos genes em proteínas específicas. Um gene normalmente codifica uma molécula de RNA mensageiro (mRNA), que, por fim, resulta na formação de uma proteína. Quando a molécula final que um gene codifica (p. ex., uma proteína) foi produzida, dizemos que o gene foi expresso. O fluxo da informação genética, fluindo do DNA para o RNA e dele para as proteínas, pode ser demonstrado da seguinte forma: DNA RNA Proteína Essa teoria foi chamada de dogma central por Francis Crick, em 1956, quando ele propôs pela primeira vez que a sequência de nucleotídeos em um DNA determina a sequência de aminoácidos de uma proteína. Genótipo e fenótipo O genótipo de um organismo é a sua constituição genética – todo o seu DNA; a informação que codifica todas as características específicas do organismo. O genótipo representa as propriedades potenciais, mas não as propriedades em si. O fenótipo refere-se às propriedades reais, expressas, como a capacidade do organismo de realizar uma reação química em particular. O fenótipo, então, é a manifestação do genótipo. De certo modo, o fenótipo de um organismo é a coleção de suas proteínas, uma vez que a maioria das propriedades de uma célula deriva de estruturas e funções das proteínas. Nos micróbios, a maioria das proteínas é enzimática (catalisa reações particulares) ou estrutural (participa em grandes complexos funcionais, como as membranas ou os flagelos). Mesmo os fenótipos que dependem de macromoléculas estruturais, como lipídeos ou polissacarídeos, baseiam-se indiretamente nas proteínas. Por exemplo, a estrutura de uma molécula de lipídeo complexo ou polissacarídeo resulta das atividades catalíticas das enzimas que sintetizam, processam e degradam essas moléculas. Assim, afirmar que os fenótipos se baseiam em proteínas é uma simplificação útil. DNA e cromossomos As bactérias geralmente têm um único cromossomo circular consistindo em uma única molécula circular de DNA com *N. de R.T. Na verdade, são bem mais do que “alguns vírus”. A maior parte dos vírus conhecidos (entre 70 e 80% deles) possui RNA como ácido nucléico hereditário. ASM: embora o dogma central seja universal em todas as células, o processo difere em procariotos e eucariotos, como veremos neste capítulo. CAPÍTULO 8 Genética microbiana 205 proteínas associadas. O cromossomo é dobrado, forma uma alça e está aderido à membrana plasmática em um ou vários pontos. O DNA de E. coli tem cerca de 4,6 milhões de pares de bases e tem aproximadamente 1 mm de comprimento – é 1.000 vezes maior do que toda a célula (Figura 8.1). Contudo, o cromossomo ocupa apenas cerca de 10% do volume da célula, uma vez que o DNA está retorcido ou superenovelado. O genoma completo não consiste em genes consecutivos. Regiões não codificantes, chamadas de repetições curtas em tandem (STRs, de short tandem repeats), ocorrem na maioria dos genomas, incluindo no de E. coli. As STRs são sequências repetitivas de 2 a 5 sequências de bases. Elas são utilizadas no fingerprinting de DNA (“impressão digital do DNA”, discutido na p. 254). Atualmente, as sequências de bases completas dos cromossomos podem ser determinadas. Computadores são utilizados na busca por janelas abertas de leitura, isto é, regiões do DNA que provavelmente codificam uma proteína. Como você verá posteriormente, essas janelas são sequências de bases entre códons de início (start codons) e de término (stop codons). O sequenciamento e a caracterização molecular dos genomas são denominados genômica. O uso da genômica no rastreamento do vírus do Oeste do Nilo é descrito no quadro Foco clínico, na página 215. O fluxo da informação genética A replicação do DNA possibilita o fluxo de informação genética de uma geração para a seguinte. Isso é chamado de transferência vertical de genes. Como mostrado na Figura 8.2, o DNA de uma célula se replica antes da divisão celular, de modo que cada célula-filha recebe um cromossomo idêntico ao da célula original. Dentro de cada célula realizando metabolismo, a informação genética contida no DNA flui de outro modo: ela é transcrita em mRNA e, então, traduzida em proteína. Descreveremos os processos de transcrição e tradução mais adiante neste capítulo. TESTE SEU CONHECIMENTO ✓ Apresente uma aplicação clínica da genômica. 8-1 ✓ Por que o pareamento de bases no DNA é importante? 8-2 Replicação do DNA Na replicação do DNA, uma molécula de DNA de dupla-fita “parental” é convertida em duas moléculas-filhas idênticas. A estrutura complementar das sequências de bases nitrogenadas na molécula de DNA é a chave para a compreensão da replicação do DNA. Como as bases ao longo das duas fitas do DNA dupla-hélice são complementares, uma fita pode agir como molde para a produção da outra (Figura 8.3a). A replicação do DNA requer a presença de diversas proteínas celulares que direcionam uma determinada sequência de eventos. As enzimas envolvidas na replicação do DNA e em outros processos estão listadas na Tabela 8.1. Quando a replicação se inicia, o superenovelamento é relaxado pela topoisomerase ou girase. As duas fitas de DNA parental são desenroladas pela helicase e separadas uma da outra em um pequeno segmento de DNA após o outro. Os nucleotídeos livres presentes no citoplasma da célula são pareados às bases expostas da fita simples de DNA parental. Onde a timina está presente na fita original, somente a adenina pode se fixar na nova fita; onde a guanina Cromossomo 1 m TEM Figura 8.1 Um cromossomo procariótico. O cromossomo é quantas vezes maior do que a célula de 2 m? Caso clínico: onde há fumaça... Marcel DuBois, homem de 70 anos e avô de 12 netos, desliga o telefone silenciosamente. O seu médico acabou de notificá- -lo sobre os resultados de seu teste de DNA de fezes, que ele havia realizado na Clínica Mayo na semana anterior. O médico de Marcel sugeriu essa nova ferramenta de triagem não invasiva para o câncer colorretal, uma vez que Marcel não estava confortável com a colonoscopia e sempre adiava o procedimento. O teste de DNA de fezes, entretanto, utiliza amostras de fezes, as quais contêm células que foram eliminadas do revestimento do colo. O DNA dessas células é testado para a presença de marcadores de DNA que podem indicar a presença de pólipos pré-cancerosos ou tumores cancerosos. Marcel marca uma consulta com seu médico para a tarde seguinte. No consultório, o médico explica para Marcel e sua esposa, Janice, que o teste de DNA de fezes detectou a presença de pólipos colorretais serrilhados. Esse tipo de pólipo é geralmente difícil de ser visualizado através da colonoscopia, uma vez que não é proeminente e pode apresentar-se da mesma cor que a parede do colo. Como o DNA pode mostrar se uma pessoa tem câncer? Leia mais para descobrir. 205 220 224 228 206 PARTE I Fundamentos de microbiologia está presente na fita parental, somente a citosina pode se fixar, e assim por diante. Quaisquer bases incorretamente pareadas são removidas e substituídas pelas enzimas de replicação. Uma vez alinhado, o nucleotídeo recém-adicionado é unido à fita em crescimento por uma enzima denominada DNA-polimerase. Então, o DNA parental se desenrola mais um pouco para permitir a adição do próximo nucleotídeo. O ponto no qual a replicação ocorre é denominado forquilha de replicação. À medida que a forquilha de replicação se move ao longo da fita parental, cada uma das fitas simples desenroladas se combina ou pareia com novos nucleotídeos. A fita original e a fita-filha recém-sintetizada se enovelam. Uma vez que cada nova molécula de DNA dupla-fita contém uma fita original (conservada) e uma fita nova, o processo de replicação é descrito como replicação semiconservativa. Antes de examinarmos em mais detalhes a replicação do DNA, discutiremos a estrutura do DNA (ver, na Figura 2.16 da p. 44, uma visão geral). É importante compreender que as fitas de DNA pareadas estão orientadas em direções opostas umas em relação às outras. Os átomos de carbono do componente açúcar de cada nucleotídeo são numerados de 1 (pronuncia-se “um linha”) a 5. Para que as bases pareadas fiquem ao lado uma da outra, os açúcares que compõem uma fita estão de cabeça para baixo uns em relação aos outros. A extremidade que tem uma hidroxila ligada ao carbono 3 é chamada de extremidade 3 da fita de DNA; a extremidade que tem um fosfato ligado ao carbono 5 é chamada de extremidade 5 da fita de DNA. A forma como as duas fitas se encaixam determina que a direção 5-3 de uma fita é contrária à direção 5-3 da outra fita (Figura 8.3b). Essa estrutura do DNA afeta o processo de replicação, pois as DNA- -polimerases podem adicionar novos nucleotídeos somente à extremidade 3. Portanto, à medida que a forquilha de replicação se movimenta ao longo do DNA parental, as duas novas fitas devem crescer em direções diferentes. A replicação do DNA necessita de uma grande quantidade de energia. Essa energia é fornecida pelos nucleo8.2 FIGURA DE BASE O fluxo da informação genética CONCEITOS-CHAVE • O DNA é o modelo para as proteínas de uma célula, incluindo enzimas. • O DNA é obtido de outra célula na mesma geração ou de uma célula parental durante a divisão celular. • O DNA pode ser expresso em uma célula ou ser transferido para outra célula através de recombinação e replicação. A informação genética pode ser transferida horizontalmente entre células da mesma geração. A informação genética pode ser transferida verticalmente para a próxima geração de células. A informação genética é utilizada dentro da célula para produzir as proteínas necessárias para o funcionamento celular. Novas combinações de genes Células-filhas Transcrição DNA Célula parental A célula realiza metabolismo e cresce Célula recombinante Tradução recombinação replicação CAPÍTULO 8 Genética microbiana 207 A A A A Fita parental Fita parental Extremidade 3 Fita-filha em formação Extremidade 5 Fita-filha G Forquilha de replicação C T C Extremidade 3 Extremidade 3 Fita parental Extremidade 5 Extremidade 5 Fita parental Açúcar desoxirribose Fosfato (a) A forquilha de replicação (b) A duas fitas de DNA são antiparalelas. O arcabouço de açúcar-fosfato de uma fita está alinhado de cabeça para baixo em relação ao cabouço da outra fita. Vire o livro de cabeça para baixo para comprovar este fato. A A C T A CG G LEGENDA T T C 1 2 2 3 3 1 A dupla-hélice do DNA parental se separa à medida que as ligações de hidrogênio fracas entre os nucleotídeos das fitas opostas se rompem em resposta à ação das enzimas de replicação. Ligações de hidrogênio se formam entre os novos nucleotídeos complementares e cada fita do molde parental forma novos pares de bases. Enzimas catalisam a formação de ligações açúcar-fosfato entre os nucleotídeos sequenciais em cada fita-filha resultante. O O O P O OH OH OH O –O –O –O –O P H2C H2C H2C H2C Extremidade 5 Extremidade 3 Extremidade 5 Extremidade 3 O O O P O O O O– O– O– O– P CH2 CH2 CH2 CH2 O O O P O O O P O O O O O O O O O O O P O HO O P C G TA G G C G G C T T A T T Adenina A T Timina Guanina G C Citosina Figura 8.3 Replicação do DNA. Qual a vantagem da replicação semiconservativa? Tabela 8.1 Enzimas importantes na replicação, expressão e reparo do DNA DNA-girase Relaxa o superenovelamento à frente da forquilha de replicação DNA-ligase Forma ligações covalentes que unem as fitas de DNA; fragmentos de Okazaki e novos segmentos no reparo por excisão DNA-polimerases Sintetiza DNA; corrige e repara o DNA Endonucleases Cliva o arcabouço de DNA em uma fita de DNA; facilita o reparo e inserções Exonucleases Cliva o DNA em uma extremidade exposta; facilita o reparo Helicase Desenovela a dupla-fita de DNA Metilase Adiciona um grupo metil a bases selecionadas no DNA recém-sintetizado Fotoliase Utiliza energia da luz visível para separar dímeros de pirimidina induzidos pela luz UV Primase Uma RNA-polimerase que sintetiza iniciadores de RNA a partir de um molde de DNA Ribozima Enzima de RNA que remove os íntrons e une os éxons RNA-polimerase Produz cópias de RNA a partir de um molde de DNA snRNP Complexo RNA-proteína que remove os íntrons e une os éxons Topoisomerase Relaxa o superenovelamento à frente da forquilha de replicação; separa círculos de DNA ao final da replicação Transposase Cliva o arcabouço do DNA, produzindo fitas simples de “extremidades coesivas” 208 PARTE I Fundamentos de microbiologia tídeos, que são, na verdade, nucleosídeos trifosfatos. Você já sabe sobre o ATP; a única diferença entre o ATP e o nucleotídeo adenina no DNA é o componente açúcar. A desoxirribose é o açúcar nos nucleosídeos utilizados para sintetizar o DNA, e os nucleosídeos trifosfatos com ribose são usados para sintetizar o RNA. Dois grupos fosfato são removidos para adicionar o nucleotídeo à fita de DNA em crescimento; a hidrólise do nucleosídeo é exergônica e fornece energia para criar as novas ligações na fita de DNA (Figura 8.4). A Figura 8.5 fornece mais detalhes sobre as muitas etapas que ocorrem nesse processo complexo. A replicação do DNA de algumas bactérias, como a E. coli, acontece bidirecionalmente ao redor do cromossomo (Figura 8.6). Duas forquilhas de replicação movem-se em direções opostas, para longe da origem de replicação. Como o cromossomo bacteriano é um círculo fechado, as forquilhas, enfim, se encontram quando a replicação é concluída. As duas alças precisam ser separadas por uma topoisomerase. Muitas evidências mostram uma associação entre a membrana plasmática bacteriana e a origem de replicação. Após a duplicação, se cada cópia da origem se liga à membrana em um polo oposto, então cada célula-filha recebe uma cópia da molécula de DNA – isto é, um cromossomo completo. A replicação do DNA é um processo impressionantemente acurado. Em geral, erros são cometidos em uma taxa de apenas 1 em cada 10 bilhões de bases incorporadas. Essa precisão em G C C OH OH Açúcar Fosfato OH OH OH T C G C G P P P P A T A T A T A G C C Fita nova Fita- -molde Quando um nucleosídeo trifosfato se liga ao açúcar, ele perde dois fosfatos. A hidrólise das ligações fosfato fornece energia para a reação. P P i Figura 8.4 Adicionando um nucleotídeo ao DNA. Por que uma fita está “de cabeça para baixo” em relação à outra fita? Por que ambas as fitas não podem se alinhar no mesmo sentido? Enzimas desenovelam a dupla-hélice parental. 1 Proteínas estabilizam o DNA parental desenovelado. 2 DNA-polimerase A fita-líder é sintetizada continuamente pela DNA- -polimerase. 3 Forquilha de replicação A fita atrasada é sintetizada descontinuamente. A primase, uma RNA-polimerase, sintetiza um iniciador de RNA curto, o qual é, então, estendido pela DNA-polimerase. 4 A DNA-polimerase degrada o iniciador de RNA e o substitui por DNA. 5 DNA- -polimerase Primase Iniciador de RNA A DNA-ligase une os fragmentos descontínuos da fita atrasada. 6 DNA-polimerase DNA-ligase Fragmento de Okazaki Fita parental 5 3 5 3 5 3 REPLICAÇÃO Figura 8.5 Resumo dos eventos na forquilha de replicação do DNA. Por que uma fita de DNA é sintetizada descontinuamente? CAPÍTULO 8 Genética microbiana 209 boa parte ocorre devido à capacidade de correção (proofreading) da DNA-polimerase. À medida que cada base nova é adicionada, a enzima avalia se a estrutura de pareamento formada está correta. Caso contrário, a enzima remove a base inapropriada e a substitui pela correta. Desse modo, o DNA pode ser replicado de maneira precisa, permitindo que cada cromossomo-filho possa ser praticamente idêntico ao DNA parental. TESTE SEU CONHECIMENTO ✓ Descreva a replicação do DNA, incluindo as funções da DNA- -girase, da DNA-ligase e da DNA-polimerase. 8-3 RNA e a síntese proteica Como a informação no DNA é utilizada para produzir as proteínas que controlam as atividades celulares? No processo de transcrição, a informação genética contida no DNA é copiada, ou transcrita, em uma sequência de bases complementares de RNA. A célula usa, então, a informação codificada nesse RNA para sintetizar proteínas específicas pelo processo de tradução. Analisaremos em mais detalhes como esses dois processos ocorrem na célula bacteriana. Transcrição em procariotos Transcrição é a síntese de uma fita complementar de RNA a partir de um molde de DNA. Discutiremos aqui a transcrição em células procarióticas. A transcrição em eucariotos será discutida na página 211. O RNA ribossomal (rRNA) é parte integral dos ribossomos, a maquinaria celular para a síntese proteica. O RNA transportador também está envolvido na síntese proteica, como veremos posteriormente. O RNA mensageiro (mRNA) transporta a informação codificada para produzir proteínas específicas do DNA aos ribossomos, onde as proteínas são sintetizadas. Durante a transcrição, uma fita de mRNA é sintetizada utilizando uma porção específica do DNA da célula como molde. Em outras palavras, a informação genética estocada na sequência de bases nitrogenadas do DNA é reescrita, de modo que a mesma informação apareça na sequência de bases do mRNA. Como na replicação do DNA, uma guanina (G) no molde de DNA determina uma citosina (C) no mRNA sendo sintetizado, e uma C no molde de DNA determina uma G no mRNA. Da mesma forma, uma timina (T) no molde de DNA determina uma adenina (A) no mRNA. Contudo, uma adenina no molde de DNA determina uma uracila (U) no mRNA, uma vez que o RNA contém uracila, em vez de timina. (A uracila tem uma estrutura química ligeiramente diferente da timina, mas o pareamento de bases ocorre da mesma maneira.) Se, por exemplo, a porção- -molde de DNA apresentar a sequência de bases 3-ATGCAT, a fita de mRNA recém-sintetizada apresentará a sequência de bases complementar 5-UACGUA. Figura 8.6 Replicação de DNA bacteriano. O que é a origem de replicação? 20 nm MEV (a) Um cromossomo de E. coli em processo de replicação (b) Replicação bidirecional de uma molécula de DNA circular bacteriano Origem de replicação Forquilha de replicação Fitas- -filhas Fita parental Término da replicação Forquilha de replicação REPLICAÇÃO Forquilha de replicação Forquilha de replicação 210 PARTE I Fundamentos de microbiologia O processo de transcrição requer uma enzima, denominada RNA-polimerase, e um suprimento de nucleotídeos de RNA (Figura 8.7). A transcrição começa quando a RNA-polimerase se liga ao DNA em um local denominado promotor. Somente uma das duas fitas de DNA serve como molde para a síntese de RNA para um determinado gene. Como o DNA, o RNA é sintetizado na direção 5 → 3. A síntese de RNA continua até que a RNA-polimerase atinja uma região no DNA denominada sítio de terminação. A transcrição permite que a célula produza cópias de curta duração dos genes, que podem ser utilizadas como uma fonte direta de informação para a síntese proteica. O mRNA atua como um intermediário entre a forma de armazenamento permanente (o DNA) e o processo que usa a informação (a tradução). Tradução Vimos como a informação genética no DNA é transferida ao mRNA durante a transcrição. Agora, veremos como o mRNA serve de fonte de informação para a síntese proteica. A síntese proteica é chamada de tradução, pois envolve a decodificação da “linguagem” dos ácidos nucleicos e a conversão desta em uma “linguagem” de proteínas. A linguagem do mRNA está em forma de códons, grupos de três nucleotídeos, como AUG, GGC ou AAA. A sequência de códons em uma molécula de mRNA determina a sequência de aminoácidos que estarão na proteína a ser sintetizada. Cada códon “codifica” um aminoácido específico. Este é o código genético (Figura 8.8). Os códons são escritos em termos de sua sequência de bases no mRNA. Observe, na Figura 8.8, que existem 64 códons possíveis, mas apenas 20 aminoácidos. Isso significa que a maioria dos aminoácidos é sinalizada por diversos códons alternativos, uma situação denominada degeneração do código. Por exemplo, a leucina tem seis códons e a alanina tem quatro. A degeneração permite uma determinada quantidade de leituras C A C A U U G G C T U C T T T A T A T T T T TT A A A A A A C G C G C G G C C G C G C G G G G A U A U A U A U C A C G A G A RNA-polimerase liga-se ao promotor e o DNA se desenovela no início de um gene. O RNA é sintetizado por um pareamento de bases complementares dos nucleotídeos livres com as bases nucleotídicas presentes na fita- -molde do DNA. O sítio de síntese move-se ao longo do DNA; o DNA transcrito se enovela novamente. A transcrição alcança o sítio de terminação. O RNA e a RNA- -polimerase são liberados e a dupla-hélice de DNA se forma novamente. 1 3 4 5 2 DNA mRNA Proteína TRANSCRIÇÃO 10 nm A RNA-polimerase ligada ao DNA AFM DNA RNA- -polimerase Síntese de RNA Fita de RNA completa Promotor (início do gene) RNA-polimerase RNA Sítio de terminação (final do gene) RNA Nucleotídeos de RNA RNA-polimerase Fita-molde de DNA Figura 8.7 O processo de transcrição. O diagrama de orientação indica a relação entre a transcrição e o fluxo global de informação genética em uma célula. Quando a transcrição cessa? CAPÍTULO 8 Genética microbiana 211 incorretas ou mutações no DNA, sem afetar a proteína final que será produzida. Dos 64 códons, 61 são códons codificadores e 3 são códons de término (sem sentido). Os códons codificadores codificam os aminoácidos, e os códons de término (também chamados de códons de parada) não o fazem. Em vez disso, os códons de término – UAA, UAG e UGA – assinalam o fim da síntese da molécula de proteína. O códon de início que inicia a síntese da molécula de proteína é AUG, que também é o códon da metionina. Nas bactérias, o códon de início AUG codifica a formilmetionina, em vez da metionina encontrada em outras partes da proteína. A metionina iniciadora é com frequência removida posteriormente, de forma que nem todas as proteínas contêm metionina. Durante a tradução, os códons de um mRNA são “lidos” sequencialmente; e, em resposta a cada códon, o aminoácido apropriado é adicionado a uma cadeia em crescimento. O local de tradução é o ribossomo, e as moléculas de RNA transportador (tRNA) reconhecem os códons específicos e transportam os aminoácidos requeridos. Cada molécula de tRNA tem um anticódon, uma sequência de três bases que é complementar ao códon. Dessa maneira, uma molécula de tRNA pode realizar o pareamento de bases com o seu códon associado. Cada tRNA também pode transportar em sua outra extremidade o aminoácido codificado pelo códon que o tRNA reconhece. As funções do ribossomo são direcionar a ligação ordenada dos tRNAs aos códons e organizar os aminoácidos trazidos em uma cadeia, produzindo por fim, uma proteína. A Figura 8.9 mostra os detalhes da tradução. As duas subunidades ribossomais, um tRNA com o anticódon UAC e a molécula de mRNA a ser traduzida, juntamente com diversos fatores proteicos adicionais, são montados. Esse complexo coloca o códon iniciador (AUG) na posição correta para permitir o início da tradução. Depois que o ribossomo conecta os dois primeiros aminoácidos por uma ligação peptídica, a primeira molécula de tRNA deixa o ribossomo, que, então, se move ao longo do mRNA até o códon seguinte. À medida que os aminoácidos corretos são alinhados um por um, ligações peptídicas são formadas entre eles, resultando em uma cadeia polipeptídica. (Ver também Figura 2.14, p. 42.) A tradução termina quando um dos três códons de término é alcançado no mRNA. O ribossomo, então, se separa em suas duas subunidades, e o mRNA e a cadeia polipeptídica recém-sintetizada são liberados. O ribossomo, o mRNA e os tRNAs tornam-se, então, disponíveis para serem novamente utilizados. O ribossomo move-se ao longo do mRNA na direção 5n 3. Esse movimento do ribossomo permite a exposição do códon de início. Ribossomos adicionais podem, então, se unir ao processo e iniciar a síntese de proteínas. Desse modo, normalmente há uma série de ribossomos unidos a um único mRNA, todos em vários estágios de síntese proteica. Nas células procarióticas, a tradução do mRNA em proteína pode começar antes mesmo de a transcrição estar completa (Figura 8.10). Como o mRNA é produzido no citoplasma em procariotos, os códons de início de um mRNA sendo transcrito estão disponíveis aos ribossomos antes mesmo de a molécula completa ter sido sintetizada. Transcrição em eucariotos Nas células eucarióticas, a transcrição acontece no núcleo. O mRNA precisa ser completamente sintetizado e transportado através da membrana nuclear para o citoplasma antes do início da transcrição. Além disso, o RNA começa a ser processado antes de deixar o núcleo. Nas células eucarióticas, as regiões dos genes que codificam as proteínas são frequentemente interrompidas por DNA não codificante. Dessa forma, os genes eucarióticos são compostos de éxons, as regiões expressas do DNA, e de íntrons, as regiões intervenientes do DNA que não codificam proteína. No núcleo, a RNA-polimerase sintetiza uma molécula, chamada de transcrito de RNA, que conSegunda posição Primeira posição Terceira posição CA G C A G U U UUU UUC UUA UUG Fen Leu UCU UCC UCA UCG Ser Tir Cis U C A G CUU CUC CUA CUG Leu CCU CCC CCA CCG Pro CAU CAC CAA CAG His Gln CGU CGC CGA CGG Arg U C A G Ile ACU ACC ACA ACG Tre AAU AAC AAA AAG Asn Lis AGU AGC AGA AGG Ser Arg U C A G GUU GUC GUA GUG Val GCU GCC GCA GCG Ala GAU GAC GAA GAG Asp Glu GGU GGC GGA GGG Gli U C A G UAU UAC UAA término UAG término Trp UGU UGC UGA término UGG AUU AUC AUA AUG Met/início Figura 8.8 O código genético. Os três nucleotídeos em um códon de mRNA são designados, respectivamente, como primeira posição, segunda posição e terceira posição do códon no mRNA. Cada grupo de três nucleotídeos especifica um aminoácido em particular, representado por uma abreviação de três letras (ver Tabela 2.5, p. 41). O códon AUG, o qual especifica o aminoácido metionina, também determina o início da síntese proteica. A palavra término identifica os códons sem sentido que sinalizam o fim da síntese proteica. Qual é a vantagem apresentada pela degeneração do código genético? 212 PARTE I Fundamentos de microbiologia tém cópias dos íntrons. Partículas denominadas pequenas ribonucleoproteínas nucleares (snRNPs, de small nuclear ribonucleoproteins) removem os íntrons e conectam os éxons. Em alguns organismos, os íntrons agem como ribozimas que catalisam sua própria remoção (Figura 8.11). * * * Em resumo, os genes são unidades de informação biológica codificada pela sequência de bases nucleotídicas no DNA. Um gene é expresso, ou transformado em um produto dentro da célula, pelos processos de transcrição e tradução. A informação genética transportada no DNA é transferida para uma molécula temporária de mRNA pela transcrição. A seguir, durante a tradução, o mRNA dirige a montagem dos aminoácidos em uma cadeia polipeptídica: um ribossomo se fixa ao mRNA, os tRNAs enviam os aminoácidos ao ribossomo, conforme orientado pela sequência de códons do mRNA, e o ribossomo monta os aminoácidos na cadeia que será a proteína recém-sintetizada. TESTE SEU CONHECIMENTO ✓ Qual o papel do promotor, do sítio de terminação e do mRNA na transcrição? 8-4 ✓ Como a produção de mRNA em eucariotos difere do processo em procariotos? 8-5 Met Leu No ribossomo montado, um tRNA carreando o primeiro aminoácido é pareado com o códon de início no mRNA. O sítio onde este primeiro tRNA se estabelece é chamado de sítio P. Um tRNA carreando o segundo aminoácido se aproxima. U A C A U G C A A U U U A Códon de início Segundo códon mRNA Os componentes necessários para 2 o início da tradução se reúnem. U A C A U G tRNA mRNA Anticódon 1 Subunidade ribossomal Subunidade ribossomal C A U A C Ribossomo Sítio P O segundo aminoácido une-se ao terceiro por outra ligação peptídica e o primeiro tRNA é liberado do sítio E. UUA U U U A GGU A A tRNA liberado 5 Gli A A U Leu Met O ribossomo continua a se mover ao longo do mRNA e novos aminoácidos são adicionados ao polipeptídeo. C C A A U G G G U U A U G U U U U A Cadeia polipeptídica em crescimento mRNA mRNA A A A A C U 6 Met Met Leu Gli Fen Fen Met DNA mRNA Proteína TRADUÇÃO Figura 8.9 O processo de tradução. O objetivo geral da tradução é produzir proteínas utilizando mRNAs como fonte de informação biológica. O ciclo complexo de eventos ilustrado aqui mostra o papel principal do tRNA e dos ribossomos na decodificação desta informação. O ribossomo atua como o sítio onde a informação codificada pelo mRNA é decodificada, bem como, o local onde os aminoácidos individuais são conectados em cadeias polipeptídicas. As moléculas de tRNA atuam como os verdadeiros “tradutores” – uma extremidade de cada tRNA reconhece um códon de mRNA específico, enquanto a outra extremidade carreia o aminoácido codificado por aquele códon. (Continua) Por que a tradução é interrompida? CAPÍTULO 8 Genética microbiana 213 Met U C A A A U A U G G G U U A mRNA O segundo códon do mRNA se pareia com um tRNA carreando o segundo aminoácido no sítio A. O primeiro aminoácido se une ao segundo por uma ligação peptídica. Isso liga o polipeptídeo ao tRNA no sítio P. U Formação da ligação peptídica Sítio A Sítio E Leu Met Fen O ribossomo move-se ao longo do mRNA até que o segundo tRNA esteja no sítio P. O próximo códon a ser traduzido é conduzido ao sítio A. O primeiro tRNA ocupa agora o sítio E. A U U A U A A U U C C A G G G U A C mRNA O ribossomo move-se ao longo do mRNA A A A Leu Quando o ribossomo atinge um códon de término, o polipeptídeo é liberado. Fen Fen Met U C U A G A U G A Polipeptídeo liberado mRNA Códon de término Met Met Finalmente, o último tRNA é liberado e o ribossomo desfaz. O polipeptídeo liberado forma uma nova proteína. Gli Gli Gli Leu Leu Arg Leu Fen Fen Met Met Met Gli Gli Gli Leu Leu Arg Leu U C U mRNA Nova proteína Met Gli U C A A A U A U G G G U U A mRNA O segundo códon do mRNA se pareia com um tRNA carreando o segundo aminoácido no sítio A. O primeiro aminoácido se une ao segundo por uma ligação peptídica. Isso liga o polipeptídeo ao tRNA no sítio P. U Formação da ligação peptídica Sítio A Sítio E Leu Met Fen O ribossomo move-se ao longo do mRNA até que o segundo tRNA esteja no sítio P. O próximo códon a ser traduzido é conduzido ao sítio A. O primeiro tRNA ocupa agora o sítio E. A U U A U A A U U C C A G G G U A C mRNA O ribossomo move-se ao longo do mRNA A A A Leu Quando o ribossomo atinge um códon de té i li tíd é lib d Fen Fen Met U C U A G A U G A Polipeptídeo liberado mRNA Códon de término Met Met Finalmente, o último tRNA é liberado e o ribossomo d f O li tíd lib d f Gli Gli Gli Leu Leu Arg Leu Fen Fen Met Met Met Gli Gli Gli Leu Leu Arg Leu U C U mRNA Nova proteína Met Gli U C A A A U A U G U U A G Leu Met Fen A U U A U A A U U C C A G G G U A C Leu Fen Fen Met U C U A G A U G A Met Met Gli Gli Gli Leu Leu Arg Leu Fen Fen Met Met Met Gli Gli Gli Leu Leu Arg Leu Gli 3 7 8 4 Figura 8.10 Transcrição e tradução simultâneas em bactérias. Muitas moléculas de mRNA são sintetizadas simultaneamente. As moléculas mais longas de mRNA foram as primeiras a serem transcritas no promotor. Observe os ribossomos ligados ao mRNA recém- -formado. A micrografia mostra um polirribossomo (muitos ribossomos) em um único gene bacteriano. Por que a tradução pode se iniciar antes do término da transcrição em procariotos, mas não em eucariotos? DNA mRNA Proteína TRADUÇÃO Direção da transcrição Polirribossomo Peptídeo RNA- -polimerase Direção da tradução Ribossomo DNA mRNA 5 60 nm MET Figura 8.9 (Continuação) 214 PARTE I Fundamentos de microbiologia A regulação da expressão gênica bacteriana OBJETIVOS DO APRENDIZADO 8-6 Definir óperon. 8-7 Explicar a regulação pré-transcricional da expressão gênica em bactérias. 8-8 Explicar a regulação pós-transcricional da expressão gênica. As maquinarias genética e metabólica de uma célula são integradas e interdependentes. A célula bacteriana realiza uma quantidade enorme de reações metabólicas (ver Capítulo 5). A característica comum de todas as reações metabólicas é que elas são catalisadas por enzimas, que, por sua vez, são proteínas sintetizadas por transcrição e tradução. A inibição por retroalimentação impede que uma célula realize reações químicas desnecessárias (Capítulo 5, p. 116) e interrompe as enzimas que já foram sintetizadas. Examinaremos agora os mecanismos que impedem a síntese de enzimas que não são necessárias. Como a síntese proteica requer uma grande quantidade de energia, as células poupam energia, produzindo apenas aquelas proteínas necessárias em um período específico. A regulação da expressão gênica é influenciada por sinais moleculares internos e externos. Analisaremos a seguir como as reações químicas são reguladas pelo controle da expressão gênica. Muitos genes, talvez 60 a 80%, não são regulados, mas são, em vez disso, constitutivos, ou seja, seus produtos são constantemente produzidos em uma velocidade fixa. Em geral, esses genes, os quais se encontram efetivamente ligados durante todo o tempo, codificam enzimas que a célula necessita em quantidades muito grandes para realizar seus principais processos vitais. As enzimas da glicólise são exemplos. A produção de outras enzimas é regulada de modo que elas estejam presentes somente quando necessário. O Trypanosoma,* o protozoário parasito que causa a doença do sono africana, tem centenas de genes que codificam glicoproteínas de superfície. Cada célula do protozoário liga somente um gene de glicoproteína por vez. Como o sistema imune do hospedeiro destrói parasitos que possuem um determinado tipo de molécula de superfície, os parasitos que expressam glicoproteínas de superfície diferentes podem continuar a crescer. Controle pré-transcricional Dois mecanismos de controle genético, conhecidos como repressão e indução, regulam a transcrição do mRNA e, consequentemente, a síntese de enzimas a partir dele. Esses mecanismos controlam a formação e as quantidades de enzimas na célula, e não a atividade das enzimas. Repressão O mecanismo regulador que inibe a expressão gênica e diminui a síntese das enzimas é denominado repressão. A repressão normalmente é uma resposta à abundância de um produto final de uma via metabólica; ela causa uma redução na velocidade da síntese das enzimas que levam à formação daquele produto. A repressão é mediada por proteínas reguladoras, denominadas repressoras, que bloqueiam a capacidade da RNA-polimerase de iniciar a transcrição dos genes reprimidos. A condição-padrão de um gene reprimível é ligado. Indução O processo que ativa a transcrição de um gene ou genes é a indução. Uma substância que inicia a transcrição de um gene é chamada de indutor, e as enzimas que são sintetizadas na presença de indutores são chamadas de enzimas indutíveis. Os genes requeridos para o metabolismo da lactose na E. coli são um exemplo bem conhecido de sistema indutível. Um desses genes codifica a enzima -galactosidase, que degrada o substrato lactose em dois açúcares simples, glicose e galactose. ( refere-se ao tipo de ligação que une a glicose e a galactose.) Se a E. coli é colocada em um meio onde a lactose não está presente, o organismo quase não contém -galactosidase; contudo, quando a lactose é adicionada ao meio, as células bacterianas produzem grande quantidade da enzima. Na célula, a lactose é convertida no composto relacionado, alolactose, que é o indutor desses genes; assim, a presença de lactose induz a célula indiretamente a sintetizar mais enzima. A circunstância-padrão de um gene indutível é desligado. O modelo óperon de expressão gênica Os detalhes do controle da expressão gênica por indução e repressão são descritos pelo modelo óperon, formulado na década de 1960 por François Jacob e Jacques Monod. O modelo mostra a indução de enzimas do catabolismo da lactose em E. coli. Além da -galactosidase, essas enzimas incluem a lac permease, que está envolvida no transporte de lactose para denASM: a regulação da expressão gênica é influenciada por sinais e/ou pistas moleculares internos e externos. *N. de R.T. No Brasil, este gênero de protozoário é importante por ser o causador da Doença de Chagas. Éxon Íntron Éxon Íntron Éxon mRNA Transcrito de RNA DNA Núcleo Citoplasma 1 No núcleo, um gene composto de éxons e íntrons é transcrito em RNA pela RNA-polimerase. 2 O processamento envolve snRNPs no núcleo, que removem RNAs derivados de íntrons e unem os RNAs oriundos de éxons em mRNA. 3 Após essas modificações, o mRNA maduro se desloca até o citoplasma, onde direciona a síntese proteica. Figura 8.11 Processamento do RNA em células eucarióticas. Por que o transcrito de RNA não pode ser utilizado para a tradução? CAPÍTULO 8 Genética microbiana 215 tro da célula, e a transacetilase, que metaboliza outros dissacarídeos que não a lactose. Os genes para as três enzimas envolvidas na captação e na utilização da lactose estão em sequência no cromossomo bacteriano e são regulados em conjunto (Figura 8.12). Esses genes, que determinam as estruturas de proteínas, são denominados genes estruturais, para diferenciá-los de uma região controladora adjacente no DNA. Quando a lactose é introduzida no meio de cultura, os genes estruturais lac são todos transcritos e traduzidos rápida e simultaneamente. Veremos agora como ocorre essa regulação. Rastreando o vírus do Oeste do Nilo No verão de 1999, o Departamento de Saúde da Cidade de Nova York identificou um grupo de seis pacientes que apresentava encefalite. Paralelamente, autoridades de saúde locais observaram um aumento nas taxas de mortalidade entre os pássaros da cidade de Nova York. Nenhuma bactéria foi cultivada do sangue ou do líquido cerebrospinal dos pacientes. Vírus transmissíveis por mosquitos são uma causa provável de encefalite asséptica durante o verão. Os arbovírus, vírus transmissíveis por artrópodes, são disseminados entre hospedeiros vertebrados suscetíveis por artrópodes hematófagos, como os mosquitos. Em seguida, foi realizado um sequenciamento do ácido nucleico de amostras isoladas de pássaros nos Centers for Disease Control and Prevention (CDC). A comparação das sequências de ácidos nucleicos obtidas com sequências depositadas em bases de dados indicou que os vírus eram intimamente relacionados ao vírus do Oeste do Nilo (WNV, de West Nile virus), que nunca havia sido isolado no hemisfério ocidental. Em 2007, o WNV foi encontrado em pássaros em todos os Estados, à exceção do Alasca e do Havaí. Em 2009, o CDC considerou o vírus do Oeste do Nilo endêmico nos Estados Unidos. Este flavivírus do Velho Mundo foi isolado pela primeira vez em 1937, no distrito do Oeste do Nilo, em Uganda. No início da década de 1950, os cientistas identificaram surtos de encefalite pelo WNV em seres humanos no Egito e em Israel. Inicialmente considerado um arbovírus de pouca importância, o WNV emergiu como um importante problema de saúde pública e veterinária no sul da Europa, na bacia do Mediterrâneo e na América do Norte. Pesquisadores analisaram o genoma do vírus em busca de pistas sobre sua disseminação ao redor do mundo. O genoma dos flavivírus consiste em um RNA de fita simples, senso positivo, composto por 10.948 pares de bases. (O RNA senso positivo pode atuar como mRNA e ser traduzido.) O vírus adquiriu diversas mutações e os pesquisadores estão em busca de pistas nessas mutações para determinar a trajetória desse vírus. 1. Utilizando as porções dos genomas (mostradas abaixo) que codificam proteínas virais, você pode determinar o quanto estes vírus são similares? Você consegue entender a sua dispersão ao redor do mundo? Determine os aminoácidos codificados e agrupe os vírus com base na porcentagem de similaridade com a amostra Uganda. 2. Com base nos aminoácidos, existem dois grupos denominados clados. Você consegue identificar esses dois grupos? 3. As amostras da América do Norte e da Austrália acumularam mais mutações, por isso, devem ser mais recentes. Calcule a porcentagem de diferença entre os nucleotídeos para determinar como os vírus estão relacionados dentro do seu clado. 4. Embora possam ser observados grupos ou clados geneticamente relacionados, a disseminação real do vírus permanece indefinida. Fonte: adaptado de dados do CDC. Austrália ACCCCGUCCACCCUUUCAAUU Egito AAUCGAUCAUCUUCGUCGAUC França AAUCGAUCAUCGUCGUCGAUC Israel AUCCAUUCAUCCUCAUCGAUU Itália AUCCACUCAUCCUCGUCGAUU Quênia AUCCACUCAUCCUCGUCGAUU México AACCCUUCCUCCCCUUCGAUU Estados Unidos AACCCCUCCUCCCCUUCGAUU Uganda AUACGAUCAUGCUCGUCCAUC FOCO CLÍNICO 40 nm Vírus do Oeste do Nilo MET 216 PARTE I Fundamentos de microbiologia ou prosseguir com a transcrição dos genes estruturais. Um conjunto de sítios operadores e promotores e os genes estruturais que eles controlam definem um óperon; portanto, a combinação dos três genes estruturais lac e as regiões de controle adjacentes é denominada óperon lac. Um gene regulador, denominado gene I, codifica uma proteína repressora que liga ou desliga os óperons indutíveis e repressíveis. O óperon lac é um óperon indutível (ver Figura 8.12). Na ausência da lactose, a proteína repressora liga-se fortemente ao sítio do operador, prevenindo a transcrição. Se a lactose está presente, o repressor liga-se ao metabólito da lactose, em vez de se ligar ao sítio operador, e as enzimas que degradam a lactose são transcritas. Nos óperons repressíveis, os genes estruturais são transcritos até que sejam desligados (Figura 8.13). Os genes para as enzimas envolvidas na síntese do triptofano são regulados desse modo. Os genes estruturais são transcritos e traduzidos, levando à síntese do triptofano. Quando um excesso de triptofano está presente, ele atua como um correpressor, ligando-se à proteína repressora. A proteína repressora pode, então, ligar-se ao operador, interrompendo a síntese adicional de triptofano. TESTE SEU CONHECIMENTO ✓ Utilize a via metabólica abaixo para responder às questões que se seguem. 8-6 a. Se a enzima a é indutível e não está sendo sintetizada no presente momento, uma proteína (1) __________ deve estar firmemente ligada ao sítio (2) __________. Quando o indutor está presente, ele se ligará ao (3)_________________de modo que (4) _______________ possa ocorrer. b. Se a enzima a é reprimível, o produto final C, chamado de (1) __________, promove a ligação da (2) __________ ao (3) __________. O que causa a desrepressão? Regulação positiva A regulação do óperon da lactose também depende do nível de glicose no meio, que, por sua vez, controla o nível intracelular da pequena molécula AMP cíclico (cAMP), uma substância derivada do ATP que atua como um sinal de alarme celular. As enzimas que metabolizam a glicose são constitutivas e as células crescem em sua velocidade máxima, tendo a glicose como sua fonte de carbono, pois podem utilizá-la de modo mais eficiente (Figura 8.14). Quando a glicose não está mais disponível, o cAMP se acumula na célula. O cAMP se liga ao sítio alostérico da proteína ativadora catabólica (CAP, de catabolic activator protein). A CAP liga-se, então, ao promotor lac, que inicia a transcrição, facilitando a ligação entre a RNA- -polimerase e o promotor. Portanto, a transcrição do óperon lac requer tanto a presença de lactose quanto a ausência de glicose (Figura 8.15). Gene regulador Promotor Operador I PO Z Y A Região de controle Óperon Genes estruturais 1 I P ZY A RNA-polimerase 2 Repressor ativo, óperon desligado. A proteína repressora liga-se ao operador, impedindo a transcrição do óperon. 3 Repressor inativo, óperon ligado. Quando o indutor alolactose se liga à proteína repressora, o repressor inativado não pode mais bloquear a transcrição. Os genes estruturais são transcritos, resultando na produção das enzimas necessárias para o catabolismo da lactose. mRNA repressor Transcrição Tradução Proteína repressora ativa I P O Z YA Transcrição Tradução óperon mRNA Alolactose (indutor) -Galactosidase Proteína repressora inativa Permease Transacetilase Estrutura do óperon. O óperon consiste em um sítio promotor (P) e um sítio operador (O) e em genes estruturais que codificam para a proteína em questão. O óperon é regulado pelo produto do gene regulador (I). DNA Figura 8.12 Um óperon indutível. As enzimas que degradam a lactose são produzidas na presença da lactose. Em E. coli, os genes para as três enzimas estão no óperon lac. A -galactosidase é codificada pelo gene lacZ. O gene lacY codifica a lac permease e o lacA codifica a transacetilase, cuja função no metabolismo da lactose ainda é incerta. O que promove a transcrição de uma enzima indutível? Na região de controle do óperon lac há dois segmentos de DNA relativamente curtos. Um, o promotor, é o segmento onde a RNA-polimerase inicia a transcrição. O outro é o operador, que atua como um semáforo de trânsito, sinalizando para parar CAPÍTULO 8 Genética microbiana 217 O cAMP é um exemplo de alarmona, um sinal de alarme químico que promove a resposta celular ao estresse ambiental ou nutricional. (Nesse caso, o estresse é a falta de glicose.) O mesmo mecanismo envolvendo o cAMP permite que a célula utilize outros açúcares. A inibição do metabolismo das fontes alternativas de carbono pela glicose é denominada repressão catabólica (ou efeito glicose). Quando a glicose está disponível, o nível de cAMP na célula é baixo e, consequentemente, a CAP não está ligada. Controle epigenético Células eucarióticas e bacterianas podem desligar genes através da metilação de determinados nucleotídeos – isto é, pela adição de um grupo metil (OCH3). Os genes metilados (desligados) são transferidos às células-filhas. Ao contrário das mutações, isso não é permanente e os genes podem ser religados em uma geração futura. Isso é chamado de herança epigenética (epigenética em genes). A epigenética pode explicar por que as bactérias se comportam de maneira diferente em biofilmes (ver quadro na p. 54). Controle pós-transcricional Alguns mecanismos reguladores interrompem a síntese proteica após a transcrição. Moléculas de RNA de fita simples de aproximadamente 22 nucleotídeos, chamadas de microRNAs (miRNAs), inibem a produção de proteínas em células eucarióticas. Em seres humanos, os miRNAs produzidos durante o I P E DCB A O I P E DCB A 2 Repressor inativo, óperon ligado. O repressor está inativo e a transcrição e a tradução prosseguem, levando à síntese do triptofano. 3 Repressor ativo, óperon desligado. Quando o correpressor triptofano liga-se à proteína repressora, o repressor ativado liga-se ao operador, impedindo a transcrição do óperon. RNA-polimerase Proteína repressora ativa Proteína repressora inativa Polipeptídeos abrangendo as enzimas para a síntese do triptofano mRNA repressor Transcrição Tradução Óperon mRNA I P E DCB A Triptofano (correpressor) I 1 Estrutura do óperon. O óperon consiste em um sítio promotor (P) e um sítio operador (O) e em genes estruturais que codificam para a proteína em questão. O óperon é regulado pelo produto do gene regulador (I). Gene regulador Promotor Operador I O Região de controle Óperon Genes estruturais DNA Figura 8.13 Um óperon reprimível. O triptofano, um aminoácido, é produzido por enzimas anabólicas codificadas por cinco genes estruturais. O acúmulo de triptofano reprime a transcrição desses genes, impedindo a síntese adicional de triptofano. O óperon trp de E. coli é mostrado aqui. O que promove a transcrição de uma enzima reprimível? Log10 do número de células Log10 do número de células (a) As bactérias crescem mais rapidamente utilizando a glicose como única fonte de carbono do que quando utilizam a lactose. (b) Bactérias crescendo em um meio contendo glicose e lactose inicialmente consomem a glicose e, em seguida, após uma curta fase lag, consomem a lactose. Durante a fase lag, o cAMP intracelular aumenta, o óperon lac é transcrito, mais lactose é transportada para a célula, e a -galactosidase é sintetizada para degradar a lactose. Tempo Tempo Glicose Lactose Toda a glicose é consumida Glicose é utilizada Fase lag Lactose é utilizada Figura 8.14 Velocidade de crescimento da bactéria E. coli utilizando glicose e lactose. Quando glicose e lactose estão presentes, por que as células utilizam primeiro a glicose? 218 PARTE I Fundamentos de microbiologia desenvolvimento permitem que diferentes células produzam diferentes proteínas. As células do coração e as células da pele têm os mesmos genes, porém as células de cada órgão produzem diferentes proteínas, devido aos miRNAs produzidos em cada tipo de célula durante o desenvolvimento. Em bactérias, RNAs curtos similares possibilitam que a célula enfrente estresses ambientais, como baixas temperaturas ou danos oxidativos. Um miRNA se pareia com um mRNA complementar, formando um RNA dupla-fita. Esse RNA dupla-fita é enzimaticamente degradado, de modo que a proteína codificada pelo mRNA não é produzida (Figura 8.16). A ação de outro tipo de RNA, o siRNA, é similar e será discutida na página 251. TESTE SEU CONHECIMENTO ✓ Qual o papel do cAMP na regulação da expressão gênica? 8-7 ✓ Como o miRNA interrompe a síntese proteica? 8-8 Alterações no material genético OBJETIVOS DO APRENDIZADO 8-9 Classificar as mutações por tipo. 8-10 Descrever duas maneiras pelas quais as mutações podem ser reparadas. 8-11 Descrever o efeito dos mutágenos sobre a taxa de mutação. 8-12 Delinear os métodos de seleção direta e indireta de mutantes. 8-13 Identificar a finalidade e descrever a metodologia do teste de Ames. O DNA de uma célula pode ser alterado por meio de mutações e transferência horizontal de genes. Mudanças no DNA resultam em variações genéticas que podem impactar a função microbiana (p. ex., formação de biofilme, patogenicidade e resistência a antibióticos). A sobrevivência e a reprodução das bactérias com um novo genótipo podem ser favorecidas por ambientes naturais e influenciadas por seres humanos, e resultam em uma enorme diversidade de microrganismos. A sobrevivência de novos genótipos é chamada de seleção natural. lacI lacZ A RNA- -polimerase pode se ligar e transcrever Sítio de ligação à CAP Sítio de ligação à CAP A RNA- -polimerase não pode se ligar CAP ativa CAP inativa cAMP DNA DNA Promotor Repressor lac inativo Operador (a) Lactose presente, glicose escassa (alto nível de cAMP). Se a glicose está escassa, o alto nível de cAMP ativa a CAP e o óperon lac produz grandes quantidades de mRNA para a digestão da lactose. lacI lacZ CAP inativa Promotor Repressor lac inativo Operador (b) Lactose presente, glicose presente (baixo nível de cAMP). Quando a glicose está presente, o cAMP está escasso e a CAP é incapaz de estimular a transcrição. Figura 8.15 Regulação positiva do operon lac. A transcrição do óperon lac ocorre na presença de lactose e glicose? E na presença de lactose e na ausência de glicose? E na presença de glicose e na ausência de lactose? 1 Ocorre a transcrição do miRNA. 2 O miRNA se liga ao mRNA-alvo, que apresenta pelo menos seis bases complementares. 3 O mRNA é degradado. miRNA DNA mRNA Figura 8.16 Os microRNAs controlam uma ampla variedade de atividades nas células. Em mamíferos, alguns miRNAs se hibridizam com RNA viral. O que aconteceria se uma mutação ocorresse no gene do miRNA? CAPÍTULO 8 Genética microbiana 219 Mutação A mutação é uma alteração permanente na sequência de bases do DNA. Essa alteração, muitas vezes, poderá acarretar uma mudança no produto codificado pelo gene em questão. Por exemplo, quando o gene para uma enzima sofre mutação, a enzima codificada pelo gene pode se tornar inativa ou menos ativa, pois sua sequência de aminoácidos foi alterada. Essa alteração no genótipo pode ser desvantajosa, ou mesmo letal, se a célula perder uma característica fenotípica de que ela necessita. Contudo, uma mutação pode ser benéfica se, por exemplo, a enzima alterada codificada pelo gene mutante tiver uma atividade nova ou intensificada que beneficie a célula. Tipos de mutações Muitas mutações simples são silenciosas (neutras); a alteração na sequência de bases do DNA não causa alterações na atividade do produto codificado pelo gene. As mutações silenciosas comumente ocorrem quando um nucleotídeo é substituído por outro no DNA, em especial em uma localização correspondente à terceira posição do códon do mRNA. Devido à degeneração do código genético, o novo códon resultante ainda pode codificar o mesmo aminoácido. Ainda que um aminoácido seja alterado, a função da proteína pode não se modificar se o aminoácido não estiver em uma porção vital da proteína, ou for muito semelhante quimicamente ao aminoácido original. O tipo mais comum de mutação envolvendo um único par de bases é a substituição de bases (ou mutação pontual), em que uma única base em um ponto na sequência do DNA é substituída por uma base diferente. Quando o DNA se replica, o resultado é a substituição de um par de bases (Figura 8.17). Por exemplo, AT pode ser substituído por GC, ou CG por GC. Se a troca de bases ocorrer dentro de um gene que codifica uma proteína, o mRNA transcrito a partir do gene transportará uma base incorreta naquela posição. Quando o mRNA é traduzido em proteína, a base incorreta pode causar a inserção de um aminoácido incorreto na proteína. Se a substituição de base resultar na substituição de um aminoácido na proteína sintetizada, essa alteração no DNA é conhecida como mutação de troca de sentido (missense) (Figura 8.18a e Figura 8.18b). Os efeitos dessas mutações podem ser drásticos. Por exemplo, a anemia falciforme é causada por uma única alteração no gene da globina, o componente proteico da hemoglobina. A hemoglobina é responsável principalmente pelo transporte de oxigênio dos pulmões aos tecidos. Uma única alteração de um A para um T em um sítio específico resulta na mudança de um ácido glutâmico para uma valina na proteína. Isso faz a molécula de hemoglobina alterar a sua forma em condições de baixo oxigênio, o que, por sua vez, altera a morfologia das hemácias. As hemácias deformadas não se movem bem nos capilares e podem restringir o fluxo sanguíneo, causando danos aos órgãos. Durante a replicação do DNA, uma timina é incorporada em oposição a uma guanina por engano. T T A A T A G C G C G T T A T T A A T A G A T T A U U G U U A U U G G U U C T T A A T A G T A C DNA parental DNA da célula-filha DNA da célula-filha DNA da célula-neta 2 Se não for corrigida, no próximo ciclo de replicação, uma adenina se pareia com a nova timina, gerando um par AT, no lugar do par GC original. 1 3 Quando o mRNA é transcrito a partir do DNA contendo esta substituição, é produzido um códon que, durante a tradução, codifica um aminoácido diferente: uma tirosina, em vez de uma cisteína. DNA da célula-filha mRNA Aminoácidos Transcrição Tradução Replicação Replicação Cisteína Tirosina Cisteína Cisteína Figura 8.17 Substituições de bases. Essa mutação leva à produção de uma proteína alterada em uma célula-neta. Uma substituição de base sempre resulta em um aminoácido diferente? 220 PARTE I Fundamentos de microbiologia Ao criar um códon de término (sem sentido, ou nonsense) no meio de uma molécula de mRNA, algumas substituições de base impedem efetivamente a síntese de uma proteína funcional completa; somente um fragmento é sintetizado. Assim, uma substituição de base que resulta em um códon sem sentido é denominada mutação sem sentido (Figura 8.18c). Além das mutações de pares de bases, existem também alterações no DNA, denominadas mutações de troca de fase de leitura (frameshift), em que um ou alguns pares de nucleotídeos são removidos ou inseridos no DNA (Figura 8.18d). Essas mutações podem alterar a “fase de leitura da tradução”, isto é, os agrupamentos de três nucleotídeos reconhecidos como códons pelo tRNA durante a tradução. Por exemplo, a deleção de um par de nucleotídeos no meio de um gene causa alterações em muitos aminoácidos a jusante do local da mutação original. As mutações de troca de fase de leitura quase sempre resultam em uma longa sequência de aminoácidos alterados e na produção de uma proteína inativa a partir do gene que sofreu mutação. Na maioria dos casos, um códon sem sentido será finalmente encontrado, e assim, encerrará a tradução. Ocasionalmente, ocorrem mutações em que números significativos de bases são adicionados (inseridos) em um gene. A doença de Huntington, por exemplo, é um distúrbio neurológico progressivo causado por bases extras inseridas em um gene específico. As substituições de base e as mutações de troca de fase de leitura podem ocorrer espontaneamente devido a erros ocasionais realizados durante a replicação do DNA. Essas mutações espontâneas aparentemente ocorrem na ausência de quaisquer agentes causadores de mutações. TESTE SEU CONHECIMENTO ✓ Como uma mutação pode ser benéfica? 8-9 Mutágenos Mutágenos químicos Agentes no ambiente, como certas substâncias químicas e a radiação, que produzem mutações direta ou indiretamente, são denominadas mutágenos. No mundo microbiano, determinadas mutações resultam na resistência a antibióticos (ver quadro no Capítulo 26, p. 756). Uma das muitas substâncias químicas sabidamente mutagênica é o ácido nitroso. A Figura 8.19 mostra como a exposição do DNA ao ácido nitroso pode converter a base adenina, de forma que ela se pareie com a citosina, em vez de com a timina usual. Quando o DNA contendo essas adeninas modificadas se replica, uma molécula-filha do DNA terá uma sequência de paTACT TCAAACCGAT T AUGAAGUUUG G A C U A TACTTCAAA CGATT AUGAAGUUU G A C U A T A TAC TCAAA CGATT AUG AGUUU G A C U A A U G C TAC TCAA CGATT C T C Met Lis Fen Gli DNA (fita-molde) mRNA Sequência de aminoácidos (a) Molécula de DNA normal Met Lis Fen Ser DNA (fita-molde) mRNA Sequência de aminoácidos (b) Mutação de troca de sentido Met (c) Mutação sem sentido AUG AGUU U A G A (d) Mutação de fase de leitura A A G Lis Leu Ala Transcrição Tradução Término Término Término Met Figura 8.18 Tipos de mutações e seus efeitos nas sequências de aminoácidos das proteínas. O que aconteceria se a base 9 em (a) fosse alterada para uma C? Caso clínico O DNA de uma pessoa pode sofrer mutações. Um nucleotídeo inadequado no DNA produz uma mutação, que pode alterar a função do gene. O câncer é um crescimento celular anormal provocado por mutações. Essas mutações podem ser hereditárias. No carro, Marcel e sua esposa, Janice, rumam do consultório médico para casa, enquanto recapitulam o histórico familiar de Marcel. O irmão de Marcel, Robert, faleceu de câncer de colo há 10 anos, mas Marcel sempre foi a imagem da saúde. Mesmo aos 70 anos, ele nunca pensou em se aposentar de sua churrascaria em Memphis, nos Estados Unidos, restaurante em que ele era sócio de seu irmão até o óbito de Robert. Quais fatores podem ter contribuído para o câncer de colo de Marcel? 205 220 224 228 CAPÍTULO 8 Genética microbiana 221 res de bases diferente do DNA parental. Por fim, alguns pares de bases AT da célula-mãe serão alterados para pares de bases GC na célula-neta. O ácido nitroso realiza uma alteração de pares de bases específica no DNA. Assim como todos os mutágenos, ele altera o DNA em localizações aleatórias. Outro tipo de mutágeno químico é o análogo de nucleosídeo. Essas moléculas são estruturalmente similares às bases nitrogenadas normais, mas possuem propriedades de pareamento de bases levemente alteradas. Exemplos, como a 2-aminopurina e a 5-bromouracila, são mostrados na Figura 8.20. Quando os análogos de nucleosídeo são oferecidos às células em crescimento, eles são incorporados aleatoriamente no DNA celular no lugar das bases normais. Então, durante a replicação do DNA, os análogos causam erros no pareamento de bases. As bases incorretamente pareadas serão copiadas durante a replicação subsequente do DNA, resultando em substituições de pares de bases nas células da progênie. Alguns fármacos antivirais e antitumorais são análogos a nucleosídeos, incluindo a AZT (azidotimidina), um dos principais fármacos utilizados no tratamento da infecção pelo HIV. Ainda, outros mutágenos químicos causam pequenas deleções ou inserções, que podem resultar em mutações de fase de leitura. Por exemplo, em certas condições, o benzopireno, que está presente na fumaça e na fuligem, é um mutágeno de troca de fase de leitura efetivo. A aflatoxina – produzida por Aspergillus flavus, um bolor que cresce em amendoins e grãos – é um muCH2OH H H O OH H H H H N N N N H H N H H N N N H O H N CH2OH O H H H H H OH G T C A C G T A G C T A T HNO2 HNO2 DNA parental normal Replicação DNA-filho normal G T C A C G G C T A DNA parental alterado G T C A C G T A G C T A DNA-filho alterado G T C A C G G C T A DNA-neto mutado G T C A C G G C T A G DNA-neto alterado G T C A C G G C T A Replicação C C C A A A (a) O nucleosídeo adenosina normalmente se pareia através de ligações de hidrogênio com um oxigênio e um hidrogênio de um nucleotídeo timina ou uracila. (b) A adenina alterada se pareia com uma citosina, em vez de com uma timina. A adenina alterada realizará o pareamento com ligações de hidrogênio com um hidrogênio e um nitrogênio de um nucleotídeo citosina. Figura 8.19 A oxidação de nucleotídeos produz um mutágeno. O ácido nitroso emitido no ar pela queima dos combustíveis fósseis oxida a adenina. O que é um mutágeno? (a) A 2-aminopurina é incorporada ao DNA no lugar de uma adenina, mas pode se parear com uma citosina, de forma que um par AT se torna um par CG. (b) A 5-bromouracila é utilizada como droga anticâncer, pois ela é confundida com a timina pelas enzimas celulares, mas se pareia com a citosina. Na próxima replicação do DNA, um par AT se torna um par GC. Nucleosídeo adenina Base nitrogenada normal Nucleosídeo 2-aminopurina Análogo Nucleosídeo timina Nucleosídeo 5-bromouracila CH2OH H H O OH H H H H N N N N H H N H H N N N H NH2 CH2OH N O H H H H H OH CH2OH H H O OH H H H O O N N H H CH3 CH2OH H H O OH H H H O O N N H H Br Figura 8.20 Análogos de nucleosídeos e as bases nitrogenadas que eles substituem. Um nucleosídeo é fosforilado e o nucleotídeo resultante é utilizado na síntese de DNA. Por que esses fármacos destroem as células? 222 PARTE I Fundamentos de microbiologia tágeno de troca de fase de leitura, assim como os corantes de acridina utilizados experimentalmente contra infecções por herpes-vírus. Os mutágenos de troca de fase de leitura geralmente possuem o tamanho e as propriedades químicas corretos para se inserir entre os pares de base da dupla-hélice de DNA. Eles podem funcionar deslocando levemente as duas fitas do DNA, deixando um intervalo ou uma protuberância em uma das fitas. Quando as fitas de DNA deslocadas são copiadas durante a síntese de DNA, uma ou mais bases podem ser inseridas ou deletadas no novo DNA de dupla-fita. De modo interessante, mutágenos de troca de fase de leitura frequentemente são agentes cancerígenos potentes. Radiação Os raios X e os raios gama são formas de radiação que são mutágenos potentes, devido à sua capacidade de ionizar átomos e moléculas. Os raios penetrantes da radiação ionizante fazem os elétrons saltarem de suas camadas habituais (ver Capítulo 2). Esses elétrons bombardeiam outras moléculas e causam mais dano, e muitos dos íons e radicais livres resultantes (fragmentos moleculares com elétrons não pareados) são altamente reativos. Alguns desses íons oxidam bases no DNA, resultando em erros na replicação e no reparo do DNA que produzem mutações (ver Figura 8.19). Uma consequência ainda mais grave é a ruptura das ligações covalentes no arcabouço de açúcar-fosfato do DNA, que causa rupturas físicas nos cromossomos. Outra forma de radiação mutagênica é a luz ultravioleta (UV), um componente não ionizante da luz solar comum. Contudo, o componente mais mutagênico da luz UV (comprimento de onda de 260 nm) é retido pela camada de ozônio da atmosfera. O efeito mais importante da luz UV direta sobre o DNA é a formação de ligações covalentes nocivas entre bases pirimídicas. As timinas adjacentes em uma fita de DNA podem fazer ligações cruzadas, formando dímeros de timina. Esses dímeros, a menos que reparados, podem causar graves danos ou morte celular, pois a célula não pode transcrever ou replicar corretamente este DNA. As bactérias e outros organismos têm enzimas que podem reparar o dano induzido pela luz ultravioleta. As fotoliases, também conhecidas como enzimas de reparo em presença da luz, utilizam energia da luz visível para separar o dímero novamente nas duas timinas originais. O reparo por excisão de nucleotídeos, mostrado na Figura 8.21, não é restrito ao dano induzido por luz UV; ele também pode reparar as mutações de outras causas. As enzimas retiram as bases incorretas e preenchem o intervalo com DNA recém-sintetizado, que é complementar à fita correta. Por muitos anos, biólogos questionaram como a base incorreta poderia ser distinguida da base correta se esta não era fisicamente distorcida como um dímero de timina. Em 1970, Hamilton Smith respondeu a essa questão com a descoberta das metilases. Essas enzimas adicionam um grupo metil às bases selecionadas imediatamente após a produção da fita de DNA. Uma endonuclease de reparo, então, cliva a fita não metilada. A exposição à luz UV em seres humanos, como no bronzeamento excessivo, provoca a formação de um grande número de dímeros de timina nas células da pele. Os dímeros não reparados podem resultar em câncer de pele. Os seres humanos que têm xeroderma pigmentoso, condição hereditária que resulta em aumento da sensibilidade à luz UV, possuem um defeito no reparo por excisão de nucleotídeos; consequentemente, eles têm um risco maior de câncer de pele. T T T T T T 1 A exposição à luz ultravioleta induz a formação de ligações cruzadas entre timinas vizinhas, gerando um dímero de timina e alterando o pareamento normal de bases. 2 Uma endonuclease cliva o DNA e uma exonuclease remove o DNA danificado. 3 A DNA-polimerase preenche a lacuna sintetizando um novo DNA, utilizando a fita intacta como molde. 4 A DNA-ligase veda a lacuna restante unindo o DNA novo e o DNA antigo. Dímero de timina Luz ultravioleta T T Novo DNA Figura 8.21 A criação e o reparo de um dímero de timina causado por luz ultravioleta. Após exposição à luz UV, timinas vizinhas formam ligações cruzadas, resultando em um dímero de timina. Na ausência de luz visível, o mecanismo de reparo por excisão de nucleotídeos é utilizado em uma célula para reparar o dano. Como as enzimas de reparo “sabem” qual é a fita incorreta? CAPÍTULO 8 Genética microbiana 223 A frequência de mutação A taxa de mutação é a probabilidade de um gene sofrer mutação quando a célula se divide. A taxa normalmente é apresentada como uma potência de 10 e, como as mutações são muito raras, o expoente é sempre um número negativo. Por exemplo, se existe uma chance em um milhão de um gene sofrer mutação quando a célula se divide, a taxa de mutação é de 1/1.000.000, a qual é expressa como 10−6. Erros espontâneos na replicação do DNA ocorrem em taxas muito baixas, talvez apenas em um em cada 109 pares de bases replicados (taxa de mutação de uma em um bilhão). Como um gene médio tem cerca de 103 pares de bases, a taxa de mutação espontânea é de cerca de uma a cada 106 (um milhão) genes replicados. As mutações normalmente ocorrem de modo relativamente aleatório ao longo de um cromossomo. A ocorrência de mutações aleatórias em baixa frequência é um aspecto essencial da adaptação das espécies ao seu ambiente, pois a evolução requer que a diversidade genética seja gerada aleatoriamente e em taxas reduzidas. Por exemplo, em uma população bacteriana de tamanho significativo – digamos, maior que 107 células – algumas novas células mutantes sempre serão produzidas a cada geração. A maioria das mutações é nociva e suscetível de ser removida do conjunto de genes quando a célula individual morre, ou quando são neutras. Contudo, algumas mutações podem ser benéficas. Por exemplo, uma mutação que confere resistência aos antibióticos é benéfica a uma população de bactérias que seja regularmente exposta a antibióticos. Uma vez que essa característica tenha surgido por mutação, as células que transportam o gene mutado têm uma maior probabilidade de sobreviver e se reproduzir, contanto que o ambiente permaneça o mesmo. Em pouco tempo, a maioria das células na população terá o gene; uma alteração evolutiva terá ocorrido, embora em pequena escala. Um mutágeno geralmente aumenta a taxa de mutação espontânea, que é de cerca de uma a cada 106 genes replicados, por um fator de 10 a 1.000 vezes. Em outras palavras, na presença de um mutágeno, a taxa normal de 10 6 mutações por gene replicado torna-se uma taxa de 10 5 a 10 3 por gene replicado. Os mutágenos são usados experimentalmente para aumentar a produção de células mutantes, para a utilização em pesquisas sobre as propriedades genéticas dos microrganismos e para objetivos comerciais. TESTE SEU CONHECIMENTO ✓ Como as mutações podem ser reparadas? 8-10 ✓ Como os mutágenos afetam a taxa de mutação? 8-11 Identificando mutantes Os mutantes podem ser detectados por seleção ou teste para um fenótipo alterado. Independentemente da utilização de um mutágeno, as células mutantes com mutações específicas sempre serão raras, comparadas a outras células na população. O problema é detectar esse evento raro. Os experimentos geralmente são realizados com bactérias, pois elas se reproduzem rapidamente; assim, um grande número de organismos (mais de 109 por mililitro de caldo nutriente) pode facilmente ser utilizado. Além disso, como as bactérias, em geral, têm apenas uma cópia de cada gene por célula, os efeitos de um gene mutado não são mascarados pela presença de uma versão normal do gene, como em muitos organismos eucarióticos. A seleção positiva (direta) envolve a detecção das células mutantes pela rejeição das células parentais não mutadas. Por exemplo, suponha que estivéssemos tentando descobrir bactérias mutantes resistentes à penicilina. Quando as células bacterianas são plaqueadas em um meio contendo penicilina, o mutante pode ser identificado diretamente. As poucas células na população que são resistentes (mutantes) crescerão e formarão colônias, ao passo que as células parentais normais, sensíveis à penicilina, não poderão crescer. Para identificar mutações em outros tipos de genes, a seleção negativa (indireta) pode ser usada. Esse processo seleciona uma célula que não pode realizar certa função, utilizando a técnica de placas em réplica. Por exemplo, suponha que desejássemos utilizar placas em réplica para identificar uma célula bacteriana que perdeu a capacidade de sintetizar o aminoácido histidina (Figura 8.22). Primeiro, cerca de 100 células bacterianas são inoculadas em uma placa de ágar. Essa placa, denominada placa mestre, contém um meio contendo histidina em que todas as células crescerão. Após 18 a 24 horas de incubação, cada célula se reproduz para formar uma colônia. Então, um carimbo de material estéril, como látex, papel filtro ou veludo, é pressionado sobre a placa mestre, e algumas das células de cada colônia aderem-se ao veludo. A seguir, o veludo é pressionado sobre duas (ou mais) placas estéreis. Uma placa contém um meio sem histidina e a outra contém um meio com histidina em que as bactérias originais, não mutantes, podem crescer. Qualquer colônia que crescer no meio com histidina na placa mestre, mas que não puder sintetizar sua própria histidina, não será capaz de crescer no meio sem histidina. A colônia mutante pode, então, ser identificada na placa mestre. É claro que, como os mutantes são muito raros (mesmo aqueles induzidos por mutágenos), muitas placas precisam ser selecionadas com essa técnica para isolar um mutante específico. A placa em réplica é um meio muito efetivo de isolar mutantes que necessitam de um ou mais fatores novos de crescimento. Qualquer microrganismo mutante com uma necessidade nutricional que esteja ausente no parental é conhecido como auxotrófico. Por exemplo, um organismo auxotrófico pode não ter a enzima necessária para sintetizar um aminoácido específico e, portanto, necessita daquele aminoácido como fator de crescimento em seu meio nutriente. Identificando carcinógenos químicos Muitos mutágenos conhecidos foram reconhecidos como carcinógenos, substâncias que causam câncer em animais, incluindo os seres humanos. Nos últimos anos, substâncias químicas no ambiente, no local de trabalho e na dieta foram implicadas como causa de câncer em seres humanos. Procedimentos de experimentação animal são demorados e dispendiosos, assim algumas 224 PARTE I Fundamentos de microbiologia metodologias mais rápidas e menos onerosas para uma triagem preliminar de potenciais carcinógenos, que não utilizam animais, foram desenvolvidas. Uma dessas, denominada teste de Ames, utiliza bactérias como indicadores de carcinógenos. O teste de Ames baseia-se na observação de que a exposição de bactérias mutantes a substâncias mutagênicas pode causar novas mutações que revertem o efeito (a alteração no fenótipo) da mutação original; essas mutações são chamadas de reversões. Especificamente, o teste mensura a reversão de auxotróficos para histidina de Salmonella (as chamadas células his– , mutantes que perderam a capacidade de sintetizar a histidina) em células capazes de sintetizar a histidina (his ) após tratamento com um mutágeno (Figura 8.23). As bactérias são incubadas tanto na presença quanto na ausência da substância a ser testada. Uma vez que as enzimas animais devem ativar muitos químicos em formas que são quimicamente reativas para que a atividade mutagênica ou carcinogênica apareça, a substância química a ser testada e as bactérias mutantes são incubadas junto com extrato de fígado de rato, uma fonte rica em enzimas de ativação. Se a substância a ser testada for mutagênica, ela provocará a reversão das bactérias his– em bactérias his em uma taxa maior do que a taxa de reversão espontânea. O número de revertentes observados fornece uma indicação do grau que uma substância é mutagênica e, assim, possivelmente carcinogênica. 1 O veludo estéril é pressionado sobre as colônias em crescimento na placa mestre. Alça Superfície de veludo (esterilizada) 2 Células de cada colônia são transferidas do veludo para novas placas. 3 As placas são incubadas. 4 O crescimento nas placas é comparado. Uma colônia que cresce no meio com histidina, mas que não pode crescer no meio sem histidina é auxotrófica (mutante que requer histidina). Placa de Petri com meio sem histidina Colônia perdida Placa de Petri com meio contendo histidina Placa mestre com meio contendo histidina Mutante auxotrófico Figura 8.22 Placas em réplica. Neste exemplo, o mutante auxotrófico não pode sintetizar histidina. As placas devem ser cuidadosamente marcadas (nesta figura, com um X) para manter a orientação, de modo que as posições das colônias sejam conhecidas em relação à placa mestre original. O que é um auxotrófico? Caso clínico Nem todas as mutações são hereditárias; algumas são induzidas por genotoxinas, isto é, substâncias químicas que danificam o material genético das células. Marcel não está acima de seu peso, faz questão de passar algum tempo com a família e nunca fumou. Desde a década de 1970, os pesquisadores estão cientes de que pessoas que consomem carne cozida e produtos derivados de carne são mais suscetíveis ao desenvolvimento de câncer de colo. As substâncias químicas suspeitas de causarem câncer são aminas aromáticas, que se formam durante o cozimento a altas temperaturas. Marcel é proprietário de sua churrascaria em Memphis há mais de 50 anos. Ele é o tipo de empregador que coloca a “mão na massa” e está sempre na cozinha supervisionando o preparo dos pratos. Toda a sua carne de churrasco é submetida ao calor alto e, então, assada a fogo lento durante horas. Marcel é considerado um especialista nessa técnica, mas agora parece que sua profissão está relacionada à sua doença. Qual teste pode ser utilizado para determinar se uma substância química é genotóxica? 205 220 224 228 CAPÍTULO 8 Genética microbiana 225 O teste pode ser usado de muitas formas. Vários mutágenos potenciais podem ser testados qualitativamente ao se colocar as substâncias químicas individuais em pequenos discos de papel em uma única placa inoculada com bactérias. O teste de Ames é rotineiramente utilizado na avaliação de novas substâncias químicas e de poluentes do ar e da água. Cerca de 90% das substâncias que tiveram o seu papel mutagênico evidenciado pelos testes de Ames também mostraram ser carcinogênicas em animais. Do mesmo modo, as substâncias mais mutagênicas, de maneira geral, demonstraram-se as mais carcinogênicas. TESTE SEU CONHECIMENTO ✓ Como você isolaria uma bactéria resistente a antibióticos? E uma bactéria sensível a antibióticos? 8-12 ✓ Qual o princípio por trás do teste de Ames? 8-13 Transferência genética e recombinação OBJETIVOS DO APRENDIZADO 8-14 Diferenciar as transferências horizontal e vertical de genes. 8-15 Comparar os mecanismos de recombinação genética nas bactérias. 8-16 Descrever as funções de plasmídeos e transposons. A recombinação genética refere-se à troca de genes entre duas moléculas de DNA para formar novas combinações de genes em um cromossomo. A Figura 8.24 mostra um tipo de mecanismo de recombinação genética. Se uma célula capturar DNA exógeno Mutágeno suspeito Extrato de fígado de rato Amostra experimental Incubação Placa experimental Colônias de bactérias revertentes Extrato de fígado de rato Controle (sem adição do mutágeno suspeito) Placa-controle Culturas de Salmonella dependentes de histidina Meio sem histidina 123 4 São preparadas duas culturas de bactérias de Salmonella que perderam a capacidade de sintetizar histidina (dependentes de histidina). O mutágeno suspeito é adicionado somente à amostra experimental; extrato de fígado de rato (um ativador) é adicionado a ambas as amostras. Cada amostra é vertida sobre uma placa contendo meio sem histidina. As placas são, então, incubadas a 37°C por 2 dias. Apenas as bactérias cujo fenótipo dependente de histidina sofreu uma reversão para o fenótipo capaz de sintetizar histidina formarão colônias. Os números de colônias nas placas experimental e controle são comparados. A placa-controle pode apresentar alguns revertentes espontâneos capazes de sintetizar histidina. As placas testadas apresentarão um aumento no número de revertentes capazes de sintetizar histidina se a substância química testada for, de fato, um mutágeno e potencial carcinógeno. Quanto maior a concentração de mutágeno utilizada, mais colônias revertentes resultarão. Incubação Figura 8.23 O teste de mutação gênica reversa de Ames. Todos os mutágenos causam câncer? 226 PARTE I Fundamentos de microbiologia (chamado de DNA doador na figura), parte dele pode inserir- -se no cromossomo da célula – processo denominado crossing over (entrecruzamento) – e alguns dos genes carreados pelos cromossomos serão trocados. O DNA se recombinou, então o cromossomo carreia agora uma parte do DNA doador. Se A e B representam o DNA de indivíduos diferentes, como eles se aproximam um do outro o suficiente para se recombinarem? Em eucariotos, a recombinação genética é um processo ordenado, que normalmente ocorre como parte do ciclo sexuado do organismo. O crossing over geralmente ocorre durante a formação das células reprodutivas, de forma que elas contêm DNA recombinante. Em bactérias, a recombinação genética pode ocorrer de diversas formas, discutidas nas próximas seções. Assim como a mutação, a recombinação genética contribui para a diversidade genética de uma população, que é a fonte da variação evolutiva. Nos organismos altamente evoluídos, como nos micróbios atuais, a recombinação provavelmente é mais benéfica do que a mutação, já que a recombinação apresenta uma menor probabilidade de destruir a função de um gene e pode reunir combinações de genes que permitem ao organismo realizar uma nova função importante. A principal proteína que constitui os flagelos da Salmonella também é uma das proteínas mais importantes que induzem nosso sistema imune a responder. Contudo, essas bactérias têm a capacidade de produzir duas proteínas flagelares diferentes. Como nosso sistema imune monta uma resposta contra as células que contêm uma forma da proteína flagelar, os organismos que produzem a segunda forma não são afetados. O tipo de proteína flagelar produzido é determinado por um evento de recombinação que, aparentemente, ocorre de modo um tanto aleatório no DNA cromossômico. Portanto, ao alterar a proteína flagelar produzida, a Salmonella pode evitar as defesas do hospedeiro. A transferência vertical de genes ocorre quando os genes são passados de um organismo para seus descendentes. As plantas e os animais transmitem seus genes por essa forma de transmissão. As bactérias podem passar seus genes não somente para seus descendentes, mas também lateralmente, para outros micróbios da mesma geração. Esse fenômeno é conhecido como transferência horizontal de genes (ver Figura 8.2). A transferência horizontal de genes entre bactérias ocorre de diversas formas. Em todos os mecanismos, a transferência envolve uma célula doadora, que doa parte de seu DNA total a uma célula receptora. Uma vez transferida, parte do DNA do doador geralmente é incorporada ao DNA do receptor; o restante é degradado por enzimas celulares. A célula receptora que incorpora o DNA doador em seu próprio DNA é denominada recombinante. A transferência de material genético entre as bactérias não é um evento frequente, podendo ocorrer em apenas 1% ou menos de toda uma população. Examinaremos em detalhes os tipos específicos de transferência genética. Transformação em bactérias Durante o processo de transformação, os genes são transferidos de uma bactéria para outra como DNA “nu” em solução. Esse processo foi demonstrado pela primeira vez há mais de 70 anos, embora não tenha sido compreendido na ocasião. Não somente a transformação mostrou que o material genético poderia ser transferido de uma célula bacteriana para outra, mas o estudo desse fenômeno acabou levando à conclusão de que o DNA é o material genético. O experimento inicial sobre a transformação foi realizado em 1928 por Frederick Griffith, na Inglaterra, trabalhando com duas linhagens de Streptococcus pneumoniae. Uma delas, uma linhagem virulenta, tem uma cápsula polissacarídica que previne a fagocitose. A bactéria cresce e causa pneumonia. A outra, uma linhagem avirulenta, não tem a cápsula e não causa doença. Griffith estava interessado em determinar se injeções de bactérias mortas pelo calor da linhagem encapsulada poderiam ser utilizadas para vacinar camundongos contra pneumonia. Como ele esperava, as injeções de bactérias encapsuladas vivas mataram os camundongos (Figura 8.25a); as injeções de bactérias não encapsuladas vivas (Figura 8.25b) ou de bactérias encapsuladas mortas (Figura 8.25c) não mataram os camundongos. Entretanto, quando as bactérias encapsuladas mortas foram misturadas a bactérias não encapsuladas vivas, e a mistura foi injetada nos camundongos, muitos deles morreram. No sangue dos camundongos mortos, Griffith encontrou bactérias encapsuladas vivas. O material hereditário (genes) das bactérias mortas ASM: variações genéticas podem impactar funções microbianas (p. ex., na formação de biofilmes, patogenicidade e resistência a drogas). 1 O DNA de uma célula se alinha com o DNA da célula receptora. Observe que há uma quebra no DNA doador. Cromossomo receptor Proteína RecA DNA doador 2 O DNA da célula doadora se alinha com os pares de bases complementares no cromossomo receptor. Esse evento pode envolver milhares de pares de bases. 3 A proteína RecA catalisa a junção das duas fitas. 4 O resultado é que o cromossomo receptor contém o novo DNA. Os pares de bases complementares entre as duas fitas serão resolvidos pela DNA-polimerase e pela ligase. O DNA doador será destruído. Agora, o receptor pode ter um ou mais novos genes. Figura 8.24 Recombinação genética por crossing over. DNA exógeno pode ser inserido em um cromossomo através da quebra e religamento deste cromossomo. Esse processo pode inserir um ou mais genes no cromossomo. Uma fotografia da proteína RecA é mostrada na Figura 3.11a, página 61. Que tipo de enzima quebra o DNA? CAPÍTULO 8 Genética microbiana 227 havia entrado nas células vivas, modificando-as geneticamente, de modo que sua progênie se apresentava encapsulada e, portanto, era virulenta (Figura 8.25d). Investigações posteriores, com base na pesquisa de Griffith, revelaram que a transformação bacteriana poderia ser realizada sem os camundongos. Um caldo foi inoculado com bactérias não encapsuladas vivas. Bactérias encapsuladas mortas foram, então, adicionadas ao caldo. Após a incubação, descobriu- -se que a cultura continha bactérias vivas que eram encapsuladas e virulentas. As bactérias não encapsuladas foram transformadas; elas adquiriram uma nova característica hereditária incorporando genes das bactérias encapsuladas mortas. O próximo passo foi extrair vários componentes químicos das células mortas, para determinar qual componente causou a transformação. Esses experimentos cruciais foram realizados nos Estados Unidos por Oswald T. Avery e colaboradores, Colin M. MacLeod e Maclyn McCarty. Após anos de pesquisa, eles anunciaram, em 1944, que o componente responsável pela transformação do S. pneumoniae inofensivo em linhagens virulentas era o DNA. Seus resultados forneceram uma das indicações conclusivas de que o DNA, realmente, é o carreador da informação genética. Desde a época do experimento de Griffith, informações consideráveis foram reunidas sobre a transformação. Na natureza, algumas bactérias, talvez após morte e lise celular, liberam seu DNA no ambiente. Então, outras bactérias podem encontrar o DNA e, dependendo da espécie em particular e das condições de crescimento, captar fragmentos do DNA e integrá-los em seus próprios cromossomos por recombinação. Uma proteína, denominada RecA (ver Figura 3.11a, p. 61), liga-se ao DNA celular e, então, ao DNA doador, causando a troca de fitas. Uma célula receptora com essa nova combinação de genes é um tipo de híbrido, ou célula recombinante (Figura 8.26). Todos os descendentes 1 Bactérias encapsuladas vivas foram injetadas em um camundongo. 2 O camundongo morreu. 1 Bactérias não encapsuladas vivas foram injetadas em um camundongo. 1 Bactérias encapsuladas mortas pelo calor foram injetadas em um camundongo. 1 Bactérias não encapsuladas vivas e bactérias encapsuladas mortas pelo calor foram injetadas em um camundongo. 2 O camundongo permaneceu saudável. 2 O camundongo morreu. 3 Colônias de bactérias encapsuladas foram isoladas do camundongo morto. 3 Algumas colônias de bactérias não encapsuladas foram isoladas do camundongo; fagócitos destruíram as bactérias não encapsuladas. 3 Nenhuma colônia foi isolada do camundongo. 3 Colônias de bactérias encapsuladas foram isoladas do camundongo morto. 2 O camundongo permaneceu saudável. (a) (b) (c) (d) RECOMBINAÇÃO Figura 8.25 Experimento de Griffith demonstrando uma transformação genética. (a) Bactérias encapsuladas vivas causaram doença e morte quando injetadas em um camundongo. (b) Bactérias não encapsuladas vivas são rapidamente destruídas pelas defesas fagocíticas do hospedeiro; assim, o camundongo permaneceu saudável após a injeção. (c) Após serem mortas pelo calor, as bactérias encapsuladas perderam a capacidade de causar doença. (d) Contudo, a combinação de bactérias não encapsuladas vivas e bactérias encapsuladas mortas pelo calor (nenhuma delas, isoladamente, causa doença) causou doença. De alguma forma, as bactérias não encapsuladas vivas foram transformadas pelas bactérias encapsuladas mortas, de modo que elas adquiriram a capacidade de formar uma cápsula e, portanto, provocar doença. Experimentos subsequentes provaram que o fator de transformação era o DNA. Por que as bactérias encapsuladas mataram o camundongo, ao passo que as bactérias não encapsuladas não o fizeram? O que provocou a morte do camundongo em (d)? 228 PARTE I Fundamentos de microbiologia dessa célula recombinante serão idênticos a ela. A transformação ocorre naturalmente entre poucos gêneros de bactérias, incluindo Bacillus, Haemophilus, Neisseria, Acinetobacter e determinadas linhagens dos gêneros Streptococcus e Staphylococcus. Mesmo que só uma pequena porção do DNA de uma célula seja transferida ao receptor, a molécula que deve atravessar a parede e a membrana celular do receptor ainda é muito grande. Quando uma célula receptora se encontra em um estado fisiológico em que pode captar o DNA doador, é descrita como competente. A competência resulta de alterações na parede celular que a tornam permeável a moléculas grandes de DNA. Conjugação em bactérias Outro mecanismo pelo qual o material genético é transferido de uma bactéria para outra é denominado conjugação. A conjugação é mediada por um tipo de plasmídeo, um fragmento circular de DNA que se replica de modo independente do cromossomo da célula (discutido na p. 230). Entretanto, os plasmídeos diferem dos cromossomos bacterianos, pois os genes que eles transportam normalmente não são essenciais para o crescimento da célula sob condições normais. Os plasmídeos responsáveis pela conjugação são transmissíveis entre as células durante a conjugação. A conjugação difere da transformação em dois aspectos principais. Primeiro, a conjugação requer o contato direto célula a célula. Segundo, as células em conjugação geralmente devem ser de tipos opostos de acasalamento; as células doadoras devem transportar o plasmídeo, e as células receptoras normalmente não. Em bactérias gram-negativas, o plasmídeo transporta genes que codificam a síntese de pili sexuais, projeções da superfície da célula doadora que entram em contato com a receptora e auxiliam a unir as duas células em contato direto (Figura 8.27a). As células bacterianas gram-positivas produzem moléculas aderentes de superfície que fazem as células entrarem em contato direto umas com as outras. No processo de conjugação, o plasmídeo é replicado durante a transferência de uma cópia do filamento simples do DNA plasmidial para o receptor, onde o filamento complementar é sintetizado (Figura 8.27b). 1 A célula receptora capta o DNA doador. 2 O DNA doador se alinha com bases complementares. a b c d Célula receptora Fragmentos de DNA DNA cromossômico da célula doadora 3 A recombinação ocorre entre o DNA doador e o DNA receptor. Célula geneticamente transformada DNA não recombinado degradado a b c d 35 B A D C B A D C b c d B A D C a D B C 5 3 Figura 8.26 O mecanismo de transformação genética em bactérias. Alguma similaridade é necessária para que o DNA doador e o DNA receptor se alinhem. Os genes a, b, c e d podem ser mutações dos genes A, B, C e D. Que tipo de enzima cliva o DNA doador? Resolução do caso clínico O teste de Ames permite uma triagem rápida da genotoxicidade das substâncias químicas. As bactérias Salmonella mutantes his– , utilizadas no teste de Ames, foram estriadas sobre placas de ágar glicose e sais mínimos. Um disco de papel saturado com 2-aminofluoreno (2-AF), uma amina aromática, é colocado na cultura. Por exemplo, a figura mostra que a reversão da mutação his– permitiu o crescimento das Salmonella. Isso indica que a substância química é mutagênica e, portanto, potencialmente carcinogênica. Existem estudos indicando que o 2-AF ativado por enzimas é mais prejudicial do que o 2-AF isoladamente, sugerindo que a interação entre dieta e microbiota intestinal é mais provável de causar câncer do que apenas a dieta. Variações na dieta produzem poucas alterações em relação aos tipos de bactérias no intestino, porém induzem mudanças drásticas na atividade metabólica dessas bactérias. A detecção de pólipos colorretais serrilhados por meio do teste de DNA de fezes de Marcel possibilitou um diagnóstico precoce do câncer colorretal. Os pólipos ofensivos foram encontrados e removidos, e Marcel foi submetido a uma quimioterapia para a eliminação de qualquer célula cancerosa remanescente em seu colo. 205 220 224 228 CAPÍTULO 8 Genética microbiana 229 Como a maioria dos trabalhos experimentais sobre conjugação foi realizada em E. coli, descreveremos o processo neste organismo. Na E. coli, o fator F (fator de fertilidade) foi o primeiro plasmídeo observado a ser transferido entre as células durante a conjugação. Doadoras carreando fatores F (células F ) transferem o plasmídeo a receptoras (células F– ), que, como resultado, tornam-se células F (Figura 8.28a). Em algumas células transportando fatores F, o fator se integra ao cromossomo, convertendo a célula F em uma célula Hfr (alta frequência de recombinação, de high frequency of recombination) (Figura 8.28b). Quando a conjugação ocorre entre uma célula Hfr e uma célula F– , o cromossomo da célula Hfr (com seu fator F integrado) se replica e uma fita parental do cromossomo é transferida para a célula receptora (Figura 8.28c). A replicação do cromossomo Hfr se inicia no meio do fator F integrado, e um pequeno fragmento do fator F conduz os genes cromossômicos para a célula F– . Normalmente, o cromossomo se rompe antes de ser transferido por completo. Uma vez dentro da célula receptora, o DNA doador pode se recombinar com o DNA receptor. (O DNA doador que não estiver integrado será degradado.) Portanto, pela conjugação com uma célula Hfr, uma célula F– pode adquirir novas versões de genes cromossômicos (assim como na transformação). Contudo, ela permanece uma célula F– , uma vez que não recebeu um fator F completo durante a conjugação. A conjugação é utilizada para mapear a localização de genes em um cromossomo bacteriano (Figura 8.29). Os genes para a síntese de treonina (tre) e leucina (leu) são os primeiros no sentido horário a partir do 0. Suas localizações foram determinadas por experimentos de conjugação. Suponha que uma conjugação é permitida por somente 1 minuto entre uma linhagem Hfr, que é his , pro , tre e leu , e uma linhagem F– , que é his– , pro– , tre– e leu– . Se F– adquirir a capacidade de sintetizar a treonina, então o gene tre está localizado no início do cromossomo, entre 0 e 1 minuto. Se após 2 minutos a célula F– se tornar tre e leu , a ordem desses dois genes no cromossomo deve ser tre, leu. Transdução em bactérias Um terceiro mecanismo de transferência genética entre bactérias é a transdução. Nesse processo, o DNA bacteriano é transferido de uma célula doadora a uma célula receptora dentro de um vírus que infecta bactérias, denominado bacteriófago, ou fago. (Os fagos serão discutidos posteriormente, no Capítulo 13.) Para compreender como a transdução funciona, consideraremos o ciclo de vida de um tipo de fago transdutor de E. coli; esse fago realiza uma transdução generalizada (Figura 8.30). Durante a reprodução dos fagos, o DNA fágico e as proteínas são sintetizados pela célula bacteriana hospedeira. O DNA do fago deve ser empacotado dentro do capsídeo proteico que o recobre. Entretanto, o DNA bacteriano, o DNA plasmidial ou até mesmo o DNA de outro vírus podem ser empacotados dentro de um capsídeo proteico fágico. Todos os genes contidos dentro de uma bactéria infectada por um fago transdutor generalizado têm probabilidades iguais de serem empacotados em um revestimento de fago e transferidos. Em outro tipo de transdução, chamado de transdução especializada, apenas determinados genes bacterianos são transferidos (ver p. 372). Em um tipo de transdução especializada, o fago codifica determinadas toxinas produzidas por seus hospedeiros bacterianos, como a toxina diftérica para Corynebacterium diphtheriae a toxina eritrogênica para Streptococcus pyogenes, e a toxina Shiga para E. coli O157:H7. TESTE SEU CONHECIMENTO ✓ Diferencie as transferências vertical e horizontal de genes. 8-14 ✓ Compare a conjugação entre os seguintes pares: F × F– , Hfr × F– . 8-15 Plasmídeos e transposons Os plasmídeos e os transposons são elementos genéticos que fornecem mecanismos adicionais para a modificação genética. Eles ocorrem nos organismos procarióticos e eucarióticos, mas Pilus sexual Célula F– Célula F+ Ponte de conjugação (a) Pilus sexual (b) Ponte de conjugação MET MET 1 m 0,3 m Figura 8.27 Conjugação bacteriana. O que é uma célula F ? 230 PARTE I Fundamentos de microbiologia a presente discussão será centrada em seu papel na alteração genética em procariotos. Plasmídeos Lembre-se, do Capítulo 4 (p. 90), que os plasmídeos são fragmentos de DNA circulares, autorreplicativos, que contêm genes e cerca de 1 a 5% do tamanho do cromossomo bacteriano (Figura 8.31a). Eles são encontrados principalmente em bactérias, mas também em alguns microrganismos eucarióticos, como Saccharomyces cerevisiae. O fator F é um plasmídeo conjugativo que transporta os genes para os pili sexuais e para a transferência do plasmídeo para outra célula. Embora os plasmídeos geralmente sejam dispensáveis, em certas condições os genes transportados pelos plasmídeos podem ser cruciais para a sobrevivência e o crescimento da célula. Por exemplo, os plasmídeos de dissimilação codificam enzimas que ativam o catabolismo de certos açúcares e hidrocarbonetos incomuns. Algumas espécies de Pseudomonas podem utilizar substâncias exóticas, como o tolueno, a cânfora e os hidrocarbonetos do petróleo, como fontes principais de carbono e energia, pois possuem enzimas catabólicas codificadas por genes transportados em plasmídeos. Essas capacidades especializadas permitem a sobrevivência dos microrganismos em ambientes muito diversos e desafiadores. Devido à sua capacidade de degradar e destoxificar uma variedade de compostos incomuns, muitos deles estão sendo estudados para um possível uso na limpeza de resíduos ambientais. (Ver quadro Aplicações, no Capítulo 2, p. 31.) A recombinação entre o fator F e o cromossomo ocorre em um sítio específico em cada um deles Inserção do fator F no cromossomo célula F Célula Hfr + Fator F integrado Célula F+ Célula F– Replicação e transferência do fator F Célula F+ Célula F+ (a) Quando um fator F (um plasmídeo) é transferido de uma célula doadora (F+) para uma receptora (F– ), a célula F– é convertida em uma célula F+. (b) Quando um fator F se integra ao cromossomo de uma célula F+, ele a transforma em uma célula de alta frequência de recombinação (Hfr). Replicação e transferência de parte do cromossomo Na célula receptora, ocorre a recombinação entre o fragmento cromossômico Hfr e o cromossomo F– Célula Hfr (c) Quando uma célula doadora Hfr transfere uma porção de seu cromossomo para uma célula receptora F– , o resultado é uma célula F– recombinante. Célula F– recombinante Hfr cell Célula F– Cromossomo bacteriano Fator F Ponte de conjugação RECOMBINAÇÃO Figura 8.28 Conjugação em E. coli. As bactérias se reproduzem durante a conjugação? CAPÍTULO 8 Genética microbiana 231 Outros plasmídeos codificam proteínas que aumentam a patogenicidade de uma bactéria. A linhagem de E. coli, que causa a diarreia infantil e a diarreia do viajante, transporta plasmídeos que codificam a produção de toxinas e permitem a fixação bacteriana às células intestinais. Sem esses plasmídeos, a E. coli é um residente inofensivo do intestino grosso; com eles, é patogênica. Outras toxinas codificadas por plasmídeos incluem a toxina esfoliativa do Staphylococcus aureus, a neurotoxina do Clostridium tetani e as toxinas do Bacillus anthracis. Outros plasmídeos contêm genes para a síntese de bacteriocinas, proteínas tóxicas que destroem outras bactérias. Esses plasmídeos foram encontrados em muitos gêneros bacterianos, sendo marcadores úteis para a identificação de certas bactérias em laboratórios clínicos. Os fatores R (fatores de resistência) são plasmídeos com significativa importância médica. Foram descobertos no Japão, no final da década de 50, após várias epidemias de disenteria. Em algumas dessas epidemias, o agente infeccioso era resistente ao antibiótico usual. Após o isolamento, descobriu-se também que o patógeno era resistente a uma série de antibióticos diferentes. Além disso, outras bactérias normais dos pacientes (como a E. coli) também demonstraram ser resistentes. Os pesquisadores logo descobriram que essas bactérias adquiriram resistência por meio da disseminação de genes de um organismo para outro. Os plasmídeos que mediaram essa transferência são os fatores R. Os fatores R transportam genes que conferem à célula hospedeira resistência a antibióticos, metais pesados ou toxinas celulares. Muitos fatores R contêm dois grupos de genes. Um grupo é denominado fator de transferência de resistência (FTR) e inclui genes para replicação do plasmídeo e conjugação. O outro grupo, o determinante r, inclui os genes de resistência; ele codifica a produção de enzimas que inativam determinados fármacos ou substâncias tóxicas (Figura 8.31a). Diferentes fatores R, quando presentes na mesma célula, podem se recombinar para Metabolismo de aminoácidos Replicação e reparo do DNA Metabolismo de lipídeos LEGENDA Metabolismo de carboidratos Síntese de membrana 10 0 20 30 40 50 60 70 80 3.480 kbp bp1 1.160 kbp 2.320 kbp 90 Figura 8.29 Mapa genético do cromossomo de E. coli. Este mapa é construído pela observação de células recombinantes após conjugação. Os números dentro do círculo indicam o número de minutos necessários para a transferência dos genes durante o acasalamento entre duas células; os números nos quadros coloridos indicam o número de pares de bases. 1 kpb 1.000 pares de bases. Quantos minutos de conjugação seriam necessários para a transferência dos genes para a síntese de membrana localizados neste cromossomo? DNA bacteriano DNA fágico DNA bacteriano receptor Muitas divisões celulares DNA bacteriano doador 1 Um fago infecta a célula bacteriana doadora. 3 Ocasionalmente, durante a montagem da partícula fágica, fragmentos de DNA bacteriano são empacotados em um capsídeo fágico. A célula doadora, então, é lisada e libera as partículas fágicas contendo o DNA bacteriano. Capsídeo proteico fágico Cromossomo bacteriano Célula doadora DNA fágico Célula receptora A célula recombinante se reproduz normalmente 2 O DNA e as proteínas do fago são produzidos e o cromossomo bacteriano é degradado em fragmentos. 4 Um fago carreando o DNA bacteriano infecta uma nova célula hospedeira, a célula receptora. 5 Pode ocorrer uma recombinação, produzindo uma célula recombinante com um genótipo diferente da célula doadora e da célula receptora. RECOMBINAÇÃO Figura 8.30 Transdução por um bacteriófago. Aqui é apresentada uma transdução generalizada, na qual qualquer DNA bacteriano pode ser transferido de uma célula para outra. Como a bactéria E. coli poderia adquirir o gene da toxina Shiga? 232 PARTE I Fundamentos de microbiologia produzir fatores R com novas combinações de genes em seus determinantes r. Em alguns casos, o acúmulo de genes de resistência dentro de um único plasmídeo, é notável. Por exemplo, a Figura 8.31a mostra um mapa genético do plasmídeo de resistência R100. Nesse plasmídeo, são carreados genes de resistência para sulfonamidas, estreptomicina, cloranfenicol e tetraciclina, bem como genes para a resistência ao mercúrio. Esse plasmídeo, em particular, pode ser transferido entre uma série de gêneros entéricos, incluindo Escherichia, Klebsiella e Salmonella. Os fatores R representam problemas bastante críticos no tratamento de doenças infecciosas com antibióticos. O uso disseminado de antibióticos na medicina e na agricultura (ver quadro no Capítulo 20, p. 573) levou à sobrevivência preferencial (seleção) de bactérias com fatores R; assim, as populações de bactérias resistentes crescem cada vez mais. A transferência de resistência entre as células bacterianas de uma população, e até mesmo entre as bactérias de diferentes gêneros, também contribui para o problema. A capacidade de se reproduzir sexuadamente com membros de sua própria espécie define uma espécie eucariótica. Contudo, uma espécie bacteriana pode conjugar e transferir plasmídeos para outras espécies. Neisseria pode ter adquirido seu plasmídeo produtor de penicilinase de Streptococcus, e Agrobacterium pode transferir plasmídeos para células vegetais (ver Figura 9.20, p. 257). Plasmídeos não conjugativos podem ser transferidos de uma célula para outra ao se introduzirem em um plasmídeo conjugativo ou em um cromossomo, ou por transformação quando são liberados de uma célula morta. A inserção é possível devido a uma sequência de inserção, que será discutida em breve. Os plasmídeos são uma ferramenta importante na engenharia genética, discutida no Capítulo 9 (pp. 242-243). Transposons Os transposons são pequenos segmentos de DNA que podem se mover (ser “transpostos”) de uma região de uma molécula de DNA para outra. Esses fragmentos de DNA têm de 700 a 40 mil pares de bases de comprimento. Na década de 1950, a geneticista estadunidense Barbara McClintock descobriu transposons no milho, porém, eles ocorrem em todos os organismos e têm sido estudados mais cuidadosamente em microrganismos. Eles podem se mover de um local para outro no mesmo cromossomo, ou para outro cromossomo ou plasmídeo. Como você pode imaginar, o movimento frequente dos transposons pode ter um efeito devastador dentro de uma célula. Por exemplo, à medida que os transposons se movem nos cromossomos, eles podem se inserir dentro dos genes, tornando- -os inativos. Felizmente, a ocorrência da transposição é relativamente rara. A frequência da transposição é comparável à taxa de mutação espontânea que ocorre nas bactérias – isto é, de 10 5 a 10–7 por geração. Todos os transposons contêm a informação para sua própria transposição. Como mostrado na Figura 8.32a, os transposons mais simples, também denominados sequências de inserção (SI), contêm somente um gene que codifica uma enzima (transposase, que catalisa a clivagem e a remontagem do DNA que ocorrem na transposição) e sítios de reconhecimento. Os sítios de reconhecimento são sequências curtas do DNA repetidas e invertidas, que a enzima reconhece como sítios de recombinação entre o transposon e o cromossomo. Os transposons complexos também transportam outros genes não conectados ao processo de transposição. Por exemplo, FTR Determinan et -r Origem de replicação Resistência ao mercúrio Resistência às sulfonamidas Resistência à estreptomicina Pilus e proteínas de conjugação Origem de transferência Resistência ao cloranfenicol Resistência à tetraciclina (a) (b) MEV 20 nm Figura 8.31 Fator R, um tipo de plasmídeo. (a) Um diagrama de um fator R, o qual apresenta duas partes: o FTR contém genes necessários para a replicação do plasmídeo e sua transferência por conjugação, e o determinante r carreia genes de resistência a quatro antibióticos diferentes e para o mercúrio; os números são pares de bases × 1.000. (b) Plasmídeos de bactérias E. coli. Por que os fatores R são importantes no tratamento de doenças infecciosas? CAPÍTULO 8 Genética microbiana 233 os transposons bacterianos podem conter genes para enterotoxinas ou para a resistência a antibióticos (Figura 8.32b). Plasmídeos, como os fatores R, frequentemente são compostos de um conjunto de transposons (Figura 8.32c). Os transposons com genes de resistência a antibióticos são de interesse prático, mas não existe limitação nos tipos de genes que os transposons podem ter. Portanto, os transposons fornecem um mecanismo natural para o movimento de genes de um cromossomo para outro. Além disso, como podem ser transportados entre células em plasmídeos ou vírus, eles também podem se disseminar de um organismo para outro ou até mesmo de uma espécie para outra. Por exemplo, a resistência à vancomicina foi transferida de Enterococcus faecalis para Staphylococcus aureus através de um transposon denominado Tn1546. Os transposons são, então, mediadores potencialmente poderosos na evolução dos organismos. TESTE SEU CONHECIMENTO ✓ Quais tipos de genes os plasmídeos carreiam? 8-16 Genes e evolução OBJETIVO DO APRENDIZADO 8-17 Discutir como a mutação genética e a recombinação fornecem material para a ocorrência da seleção natural. Vimos como a atividade dos genes pode ser controlada pelos mecanismos reguladores internos das células e como os genes em si podem ser alterados ou redistribuídos por mutação, transposição e recombinação. Todos esses processos fornecem diversidade aos descendentes das células. A diversidade fornece o material bruto para a evolução, e a seleção natural fornece a sua força motriz. A seleção natural atuará em diversas populações para assegurar a sobrevivência dos indivíduos aptos àquele ambiente específico. Os diferentes tipos de microrganismos que existem hoje são o resultado de uma longa história de evolução. Os microrganismos têm continuamente sido modificados devido a alterações em suas propriedades genéticas e à aquisição de adaptações a muitos hábitats diferentes. Veja, no quadro sobre resistência a antibióticos, no Capítulo 26, página 573, um exemplo de seleção natural. TESTE SEU CONHECIMENTO ✓ A seleção natural significa que o ambiente favorece a sobrevivência de alguns genótipos. De onde vem a diversidade nos genótipos? 8-17 Resistência à canamicina Tn5 IS1 Gene da transposase Gene da transposase IS1 Repetição invertida A T C G T A T A A T C G T A G C A T T A A T T A C G A T G C T A A T A T G C T A Repetição invertida IS1 (c) Inserção do transposon Tn5 no plasmídeo R100. IS1 IS1 A T C G T A T A A T C G T A G C A T A T G A C T A A T G T T A A T T A C G A T G C T A A T A T G C T A 1 A transposase cliva o DNA, produzindo extremidades coesivas. 2 As extremidades coesivas do transposon e o DNA-alvo se anelam. A T C Resistência à canam ci ni a (a) Uma sequência de inserção (SI), o transposon mais simples, contém um gene para a transposase, a enzima que catalisa a transposição. O gene da transposase está ligado em cada extremidade a sequências de repetição invertidas (RI) que atuam como sítios de reconhecimento para o transposon. A SI1 é um exemplo de uma sequência de inserção, mostrada aqui com sequências RI simplificadas. (b) Os transposons complexos carreiam outros materiais genéticos além do gene da transposase. O exemplo mostrado aqui, o Tn5, carreia o gene de resistência à canamicina e possui cópias completas da sequência de inserção SI1 em cada extremidade. Figura 8.32 Transposons e inserção. Por que os transposons muitas vezes são chamados de “genes saltadores”? 234 PARTE I Fundamentos de microbiologia Resumo para estudo Estrutura e função do material genético (pp. 204-214) 1. Genética é o estudo do que são os genes, como eles transportam informação, como sua informação é expressa e como eles são replicados e passados às gerações seguintes ou a outros organismos. 2. O DNA nas células existe como hélice de dupla-fita; as duas fitas são mantidas unidas por ligações de hidrogênio entre pares de bases nitrogenadas específicas: AT e CG. 3. Um gene é um segmento de DNA, uma sequência de nucleotídeos, que codifica um produto funcional, geralmente uma proteína. 4. O DNA em uma célula é duplicado antes que a célula se divida; então, cada célula-filha receberá a mesm a informação genética. Genótipo e fenótipo (p. 204) 5. O genótipo é a composição genética de um organismo, seu complemento integral de DNA. 6. O fenótipo é a expressão dos genes: as proteínas da célula e as propriedades que elas conferem ao organismo. DNA e cromossomos (pp. 204-205) 7. O DNA em um cromossomo existe como uma longa dupla-hélice, associada a várias proteínas que regulam a atividade genética. 8. Genômica é a caracterização molecular dos genomas. O fluxo da informação genética (p. 205) 9. Após a divisão celular, cada célula-filha recebe um cromossomo que é virtualmente idêntico ao parental. 10. A informação contida no DNA é transcrita em RNA e traduzida em proteínas. Replicação do DNA (pp. 205-209) 11. Durante a replicação do DNA, as duas fitas da dupla-hélice se separam na forquilha de replicação, e cada fita é usada como um molde pelas DNA-polimerases para sintetizar duas fitas novas de DNA, de acordo com as regras do pareamento de bases complementares. 12. O resultado da replicação do DNA é a produção de duas fitas novas de DNA, cada qual apresentando uma sequência de bases complementar a uma das fitas originais. 13. Como cada molécula de DNA de dupla-fita contém uma fita original e uma fita nova, o processo de replicação é denominado semiconservativo. 14. O DNA é sintetizado em uma direção designada 5 → 3. Na forquilha de replicação, a fita-líder é sintetizada continuamente, e a fita atrasada, descontinuamente. 15. A DNA-polimerase verifica as novas moléculas de DNA e remove as bases pareadas incorretamente antes de continuar a síntese do DNA. RNA e síntese proteica (pp. 209-214) 16. Durante a transcrição, a enzima RNA-polimerase sintetiza uma fita de RNA a partir de uma das fitas do DNA de dupla-fita, que serve como molde. 17. O RNA é sintetizado a partir de nucleotídeos contendo as bases A, C, G e U, que se pareiam com as bases da fita de DNA a ser transcrita. 18. A RNA-polimerase liga-se ao promotor; a transcrição se inicia no sítio AUG; a região do DNA que determina o término da transcrição é chamada de sítio de terminação; o RNA é sintetizado na direção 5 → 3. 19. Tradução é o processo no qual a informação contida na sequência de bases de nucleotídeos do mRNA é utilizada para ditar a sequência de aminoácidos de uma proteína. 20. O mRNA se associa aos ribossomos, que consistem em rRNA e proteína. 21. Os segmentos de três bases do mRNA que especificam os aminoácidos são denominados códons. 22. O código genético refere-se às relações entre a sequência de bases nucleotídicas do DNA, os códons correspondentes do mRNA e os aminoácidos que os códons codificam. 23. Aminoácidos específicos encontram-se aderidos a moléculas de tRNA. Outra porção do tRNA tem um grupo de três bases, denominado anticódon. 24. O pareamento de bases dos códons e anticódons no ribossomo resulta na captação de aminoácidos específicos para o local da síntese proteica. 25. O ribossomo move-se ao longo da fita de mRNA à medida que os aminoácidos se associam, formando um polipeptídeo em crescimento; o mRNA é lido na direção 5→ 3. 26. A tradução termina quando o ribossomo atinge um códon de término (stop codon) no mRNA. A regulação da expressão gênica bacteriana (pp. 214-218) 1. A regulação da síntese proteica no nível genético é eficiente em termos de energia, pois as proteínas são sintetizadas somente quando necessário. 2. Os genes constitutivos são expressos a uma taxa fixa. Exemplos são os genes para as enzimas da glicólise. Controle pré-transcricional (pp. 214-217) 3. Quando as células são expostas a um produto final específico, a síntese das enzimas relacionadas àquele produto é reprimida. 4. Na presença de certas substâncias químicas (indutores), as células sintetizam mais enzimas. Esse processo é denominado indução. 5. Nas bactérias, um grupo de genes estruturais regulados coordenadamente com funções metabólicas relacionadas, além dos sítios promotor e operador que controlam sua transcrição, é denominado óperon. 6. No modelo óperon para um sistema indutível, um gene regulador codifica a proteína repressora. 7. Quando o indutor está ausente, o repressor liga-se ao operador, e nenhum mRNA é sintetizado. 8. Quando o indutor está presente, este liga-se ao repressor, de modo que ele não pode se ligar ao operador; portanto, o mRNA é produzido, e a síntese da enzima é induzida. 9. Em sistemas repressíveis, o repressor requer um correpressor, a fim de ligar-se ao sítio operador; portanto, o correpressor controla a síntese da enzima. 10. A transcrição de genes estruturais para enzimas catabólicas (como a -galactosidase) é induzida pela ausência de glicose. O AMP cíclico e a CAP devem se ligar a um promotor na presença de um carboidrato alternativo. 11. Nucleotídeos metilados não são transcritos no controle epigenético. CAPÍTULO 8 Genética microbiana 235 Controle pós-transcricional (pp. 217-218) 12. Os microRNAs se associam ao mRNA; o RNA de dupla-fita resultante é destruído. Alterações no material genético (pp. 218-225) 1. As mutações e a transferência horizontal de genes podem alterar o genótipo de uma bactéria. Mutação (p. 219) 2. A mutação é uma alteração na sequência de bases nitrogenadas do DNA; essa alteração modifica o produto codificado pelo gene mutado. 3. Muitas mutações são neutras, algumas são desvantajosas e outras são benéficas. Tipos de mutações (pp. 219-220) 4. Uma substituição de base ocorre quando um par de bases no DNA é substituído por um par diferente. 5. Alterações no DNA podem resultar em mutações de troca de sentido (missense; que causam substituições de aminoácidos) ou sem sentido (nonsense; que criam códons de término – stop codons). 6. Em uma mutação de troca de fase de leitura (frameshift), um ou alguns pares de bases são deletados ou adicionados ao DNA. 7. As mutações espontâneas ocorrem sem a presença de um mutágeno. Mutágenos (p. 220-222) 8. Os mutágenos são agentes ambientais que causam alterações permanentes no DNA. 9. Os mutágenos químicos incluem os mutágenos de pares de bases, os análogos de nucleosídeos e os mutágenos de troca de fase de leitura. 10. A radiação ionizante causa a formação de íons e radicais livres que reagem com o DNA; isso resulta em substituições de base ou rompimento do arcabouço de açúcar-fosfato. 11. A radiação ultravioleta (UV) não é ionizante; ela causa ligações entre as timinas vizinhas. A frequência de mutação (p. 223) 12. A taxa de mutação é a probabilidade de um gene sofrer mutação quando uma célula se dividir; a taxa é expressa como 10 elevado a uma potência negativa. 13. As mutações normalmente ocorrem de modo aleatório ao longo de um cromossomo. 14. Uma taxa baixa de mutações espontâneas é benéfica, fornecendo a diversidade genética necessária para a evolução. Identificando mutantes (p. 223) 15. Os mutantes podem ser detectados por seleção ou teste para um fenótipo alterado. 16. A seleção positiva envolve a seleção de células mutantes e a rejeição de células não mutadas. 17. A placa réplica é usada para a seleção negativa – para detectar, por exemplo, auxotróficos que têm necessidades nutricionais que a célula parental (não mutada) não tem. Identificando carcinógenos químicos (pp. 223-225) 18. O teste de Ames é um exame rápido e de custo relativamente baixo para identificar possíveis carcinógenos químicos. 19. O teste presume que uma célula mutante pode reverter para uma célula normal na presença de um mutágeno e que muitos mutágenos são carcinógenos. Transferência genética e recombinação (pp. 225-233) 1. A recombinação genética, o rearranjo dos genes a partir de grupos separados de genes, normalmente envolve o DNA de organismos diferentes; ela contribui para a diversidade genética. 2. No crossing over, os genes de dois cromossomos são recombinados em um novo cromossomo, que contém alguns genes de cada cromossomo original. 3. A transferência vertical de genes ocorre durante a reprodução quando os genes são passados de um organismo para seus descendentes. 4. A transferência horizontal de genes nas bactérias envolve a transferência de um fragmento do DNA da célula de um doador para um receptor, 5. Quando parte do DNA do doador é integrada ao DNA do receptor, a célula resultante é denominada recombinante. Transformação em bactérias (pp. 226-228) 6. Durante este processo, os genes são transferidos de uma bactéria para outra como DNA “nu” em solução. Conjugação em bactérias (pp. 228-229) 7. Este processo requer o contato entre células vivas. 8. Um tipo de célula doadora genética é uma F ; células receptoras são F . As células F contém plasmídeos chamados de fatores F; estes são transferidos para as células F durante a conjugação. Transdução em bactérias (p. 229) 9. Neste processo, o DNA é passado de uma bactéria para outra em um bacteriófago, sendo, então, incorporado ao DNA do receptor. 10. Na transdução generalizada, quaisquer genes bacterianos podem ser transferidos. Plasmídeos e transposons (p. 229-233) 11. Os plasmídeos são moléculas de DNA circulares autorreplicativas, que transportam genes que geralmente não são essenciais para a sobrevivência da célula. 12. Existem vários tipos de plasmídeos, incluindo plasmídeos conjugativos, plasmídeos de dissimilação, plasmídeos que transportam genes para toxinas ou bacteriocinas e fatores de resistência. 13. Os transposons são pequenos segmentos de DNA que podem se mover de uma região para outra do mesmo cromossomo, ou para um cromossomo diferente ou para um plasmídeo. 14. Os transposons complexos podem transportar qualquer tipo de gene, incluindo genes de resistência a antibióticos, sendo, portanto, considerados um mecanismo natural de transposição de genes de um cromossomo para outro. Genes e evolução (p. 233) 1. A diversidade é a pré-condição para a evolução. 2. A mutação e a recombinação genética fornecem uma diversidade de organismos, e o processo de seleção natural permite o crescimento daqueles mais bem adaptados a um determinado ambiente.